173,051 results
-
Plasmid#92074PurposeThis is an expression plasmid for production of recombinant genomic SFV RNA encoding beta-galactosidase.DepositorInsertlacZ
UseLacz expression plasmid, for run-off transcriptio…Available SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRC0940 (circRNA entry vector)
Plasmid#189967PurposeCloning vector for generating template plasmids to transcribe circRNA, with mNeonGreen dropout following BsaI digestionDepositorInsertmNeonGreen
ExpressionMammalianPromoterT7Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJT305 Pa01 Lenti pEF-attB LSR GFP
Plasmid#184948PurposeLentiviral delivery of recombinase landing padDepositorInsertPa01 Lenti pEF1a-attB LSR GFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ihSyn1-tTA
Plasmid#99120PurposeAn AAV genome that expresses tTA from the hSyn1 promoter that contains a positive feedback loop for amplifed expression of the tTADepositorHas ServiceAAV1InserttTA
UseAAVExpressionMammalianMutation*(see below)PromoterihSyn1Available SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-cFos-mCh
Plasmid#193066Purposeconstitutive expression of mouse cFos fused to mCherry in mammalian cellsDepositorInsertcfos-mCh
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
CVS-N2c-nl.EGFP-FlpO
Plasmid#172379PurposeProduction of RVdG-CVS-N2c viral vectors for cell-type specific trans-synaptic retrograde labeling.DepositorInsertnuclear-localized EGFP + FlpO
UseNeurotropic virusAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ421 - Pmyo-2::GFP::H2B (pharynx)
Plasmid#34876DepositorInsertPmyo-2 GFP H2B tbb-2 UTR
UseWorm targetingMutationS65CPromotermyo-2Available SinceMarch 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit HC
Plasmid#221357PurposeMammalian expression of Anti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit HC; to be used with Anti-DYKDDDDK [IPI-4E11/M1] light chain (Plasmid 221358) to make the antibody.DepositorInsertAnti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTipi2.1_Anti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit LC kappa
Plasmid#221358PurposeMammalian expression of Anti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit LC kappa; to be used with Anti-DYKDDDDK [IPI-4E11/M1] heavy chain (Plasmid 221357) to make the antibody.DepositorInsertAnti-DYKDDDDK [IPI-4E11/M1] Mouse/Rabbit LC kappa
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pQE-WT-CTGA-R13-AKSIRV
Plasmid#63627PurposeCTGA-R13-AKSIRV RNAP mutantDepositorInsertCTGA-R13-AKSIRV RNAP
Tagsn/aMutationV725A, Q744K, L747I, N748S, L749I, R756T, Q758K, …PromoterT5/LacAvailable SinceJune 3, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
Green cGull
Plasmid#86867PurposeGreen fluorescent probe for cGMPDepositorInsertGreen cGull
ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro IRES-EGFP
Plasmid#14430DepositorHas ServiceCloning Grade DNAInsertIRES-EGFP
UseRetroviralExpressionMammalianAvailable SinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE-WT-T3-R5-RRVH
Plasmid#63623PurposeT3-R5-RRVH RNAP mutantDepositorInsertT3 RRVH RNAP
MutationT745K, N748D, L749M, M750I, G753R, H772R, E775V, …PromoterT5/LacAvailable SinceJuly 29, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTriEx4-H6-FGAm (FlincG3)
Plasmid#49202PurposeFluorescent reporter for cGMPDepositorInsertFlincG3
TagsHis tag + other tagsExpressionBacterial, Insect, and Mamm…MutationMet to Lys in cpEGFP region similar to CGaMP3PromoterCMVAvailable SinceFeb. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
p42Hyg 3-F GW
Plasmid#58559PurposeMulticopy vector with Hygromycin resistance marker for triple Gateway insertionDepositorTypeEmpty backboneExpressionYeastAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNL-EGFP/TRETightdU3
Plasmid#18660DepositorInsertEGFP
UseLentiviralAvailable SinceJuly 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-std
Plasmid#109417PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody. VHH-std also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMBP-LbCas12a
Plasmid#113431PurposeExpresses 10xHis-MBP fused to LbCas12aDepositorHas ServiceCloning Grade DNAInsertLbCas12a
TagsMBPExpressionBacterialPromoterT7Available SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only