We narrowed to 24,135 results for: CRISPR
-
Plasmid#101179PurposeHuman expression plasmid for SpCas9 Cluster 1 + Q926A variant: CMV-T7-hSpCas9-Cluster1+Q926A(N692A, M694A, Q695A, H698A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1+Q926A(N692A/M694A/Q695A/H698A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/Q695A/H698A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
MMW3914 - human expression plasmid for SpCas9 Cluster 1 H698 + Q926A
Plasmid#101180PurposeHuman expression plasmid for SpCas9 Cluster 1 H698 + Q926A variant: CMV-T7-hSpCas9-Cluster1H698+Q926A(N692A, M694A, Q695A, Q926A)-NLS(SV40)-3xFLAGDepositorInserthSpCas9-Cluster1H698+Q926A(N692A/M694A/Q695A/Q926A)
Tags3x FLAG and NLS (SV40)ExpressionMammalianMutationN692A/M694A/Q695A/Q926APromoterCMVAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1D4 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4A6-mCherry
Plasmid#73424PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4A6.DepositorInsertPromoter 4A6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4A6 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1E4-mCherry
Plasmid#73426PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1E4.DepositorInsertPromoter 1E4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1E4 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1B6-mCherry
Plasmid#73420PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1B6.DepositorInsertPromoter 1B6 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1B6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3H5-mCherry
Plasmid#73419PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3H5.DepositorInsertPromoter 3H5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3H5 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hOrf2mor-NLS(sv40) (BPK5095)
Plasmid#115141PurposeCMV-T7 promoter expression plasmid for human codon optimized Orf2mor anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized Orf2mor anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailabilityAcademic Institutions and Nonprofits only -
pLV-TET2BlastR-Cas9-TagBFP
Plasmid#236726PurposeDox Inducible Cas-TagBFP expressionDepositorInsertCas9-TagBFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY116 (pcDNA3.1-huMb2Cpf1)
Plasmid#92292PurposeExpression of humanized Mb2Cpf1DepositorInserthuMb2Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY111 (pcDNA3.1-huTsCpf1)
Plasmid#92267PurposeExpression of humanized TsCpf1DepositorInserthuTsCpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBHM2645
Plasmid#229529PurposeCarries mIAA7_opt tag, empty sgRNA, and NATR markerDepositorInsertmIAA7_opt - empty sgRNA - NATR
UseCRISPRTags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pY117 (pcDNA3.1-huMb3Cpf1)
Plasmid#92293PurposeExpression of humanized Mb3Cpf1DepositorInserthuMb3Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY113 (pcDNA3.1-huPb2Cpf1)
Plasmid#92272PurposeExpression of humanized Pb2Cpf1DepositorInserthuPb2Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY119 (pcDNA3.1-huLb5Cpf1)
Plasmid#92295PurposeExpression of humanized Lb5Cpf1DepositorInserthuLb5Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY118 (pcDNA3.1-huLb4Cpf1)
Plasmid#92294PurposeExpression of humanized Lb4Cpf1DepositorInserthuLb4Cpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFG018
Plasmid#62817PurposeBacterial inducible gRNA expression plasmidDepositorInsertgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPBADAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
HCP8
Plasmid#166110PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Whi5DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pY124 (pcDNA3.1-huBsCpf1)
Plasmid#92300PurposeExpression of humanized BsCpf1DepositorInserthuBsCpf1
TagsNLS and NLS-3xHAExpressionMammalianAvailable SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYJ10-XLone-ND1
Plasmid#131055PurposeDox-induced expression of NeuroD1DepositorInsertNeuroD1 (Neurod1 Mouse)
ExpressionMammalianAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKS1461
Plasmid#239515PurposeExpress the lower portion of melvaonate pathway enzymes (Erg12p, Erg8p, and Erg19p) in the peroxisome; chromosomal integration by CRISPRDepositorInsertScErg12p-ePTS1
ExpressionYeastAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203A-CMV-5’DR-EGFP-bGHpolyA
Plasmid#221452PurposeEGFP reporter construct with single unprocessed direct repeat (35nt) at 5' endDepositorInserteGFP
ExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
1203B-CMV-3’DR-EGFP-bGHpolyA
Plasmid#221453PurposeEGFP reporter construct with single unprocessed direct repeat (35nt) at 3' endDepositorInserteGFP
ExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only