We narrowed to 9,718 results for: CAG
-
Plasmid#76333Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CGDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
LMTK2 gRNA (BRDN0001148094)
Plasmid#76175Purpose3rd generation lentiviral gRNA plasmid targeting human LMTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK1 gRNA (BRDN0001148112)
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BUB1B gRNA (BRDN0001148077)
Plasmid#75918Purpose3rd generation lentiviral gRNA plasmid targeting human BUB1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDG459-HNRNPD-KO
Plasmid#233287PurposeHNRNPD KnockoutDepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IARS2-tb
Plasmid#232340PurposeExpresses human IARS2 with synonymous mutations (to prevent recognition by siRNA) in mammalian cellsDepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutation5 synonymous mutations in the siRNA (ACUUGCAGUCAU…PromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001148068)
Plasmid#77403Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCYL1 gRNA (BRDN0001146995)
Plasmid#76065Purpose3rd generation lentiviral gRNA plasmid targeting human SCYL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK11A gRNA (BRDN0001147530)
Plasmid#75892Purpose3rd generation lentiviral gRNA plasmid targeting human CDK11ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-Opti-sgHSCB.2-puro
Plasmid#257582PurposesgRNA targeting HSCBDepositorInsertHSCB (HSCB Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-Opti-sgABCB7.1-puro
Plasmid#257583PurposesgRNA targeting ABCB7DepositorInsertABCB7 (ABCB7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-Opti-sgFECH.2-puro
Plasmid#257586PurposesgRNA targeting FECHDepositorInsertFECH (FECH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-Opti-sgFECH.1-puro
Plasmid#257585PurposesgRNA targeting FECHDepositorInsertFECH (FECH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-Opti-sgSPG7.2-puro
Plasmid#257575PurposesgRNA targeting SPG7DepositorInsertSPG7 (SPG7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only