We narrowed to 16,375 results for: grna
-
Plasmid#91073PurposeModule B, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, structurally optimized gRNA scaffold, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAtU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
TC1078-30
Plasmid#164878Purpose30bp(mismatch17) cas13d gRNA for 1405 editingDepositorInsertgRNA for TC1405
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDR348 FANCF
Plasmid#47510Purposehuman gRNA expression vector targeting FANCFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-3-3xFLAG-dCas9-HA-2xNLS
Plasmid#106354PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_RAF1_94
Plasmid#111826PurposeKnockout Raf1DepositorInsertgRNA targeting RAF1 94-114 (RAF1 Human)
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106352PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPTG-GG-sg2+sg3
Plasmid#127199PurposePlasmid expressing sgRNA2 (TACCACATTTGTAGAGGTT) & sgRNA3 (CAATGTATCTTATCATGTC) as polycistronic tRNA-gRNA from single U6 promoterDepositorInserttRNA-gRNA
UseEmpty sgrna plasmidExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gMYOD1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106355PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of MYOD1 locusDepositorInsertMYOD1 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516b
Plasmid#91085PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, structurally optimized gRNA scaffold, (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-2-3xFLAG-dCas9-HA-2xNLS
Plasmid#106353PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGTPA-lb
Plasmid#171528PurposePlasmid contains the Cas12k gRNA for mutant library constructionDepositorInsertCas12k gRNA
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGTPA
Plasmid#171525PurposePlasmid contains the Cas12k gRNA and transposon donor cassetteDepositorInsertCas12k gRNA, transposon donor cassette
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbmiR164e/h
Plasmid#231156PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbmiR164e/hDepositorInsertTREX2 and mobile gRNA targeting NbmiR164e/h
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbATML1-1pro
Plasmid#231149PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbATML1-1proDepositorInsertTREX2 and mobile gRNA targeting NbATML1-1pro
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbSTM-5'UTR
Plasmid#231148PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbSTM-5?UTRDepositorInsertTREX2 and mobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL655
Plasmid#231165PurposeT-DNA encoding gRNA targeting SlPDSDepositorInsertgRNA targeting SlPDS
ExpressionPlantPromoterAtU6Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only