We narrowed to 8,554 results for: sgRNA
-
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVTagsExpressionMutationCas9 D10APromoterCbhAvailable sinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD
Plasmid#169818PurposeExpresses C-terminal flag-tagged CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCCC -> AGTC silent mutations at nt527-530 eli…PromoterAvailable sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv4
Plasmid#221432PurposeLentiviral CRISPR/Cas9 vector for co-expression of sgRNAs and Cas9 protein.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRTagsExpressionMammalianMutationPromoterPgkAvailable sinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa1-Cas9-GFP
Plasmid#208049PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1DepositorInsertsgPRKAA1 (PRKAA1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9_sgAAVS1
Plasmid#199213PurposeAll-in-one plasmid encoding eSpCas9 and sgRNA targeting the AAVS1 site in human cells.DepositorInsertAAVS1-gRNA
UseCRISPRTagsExpressionMutationPromoterhuman U6Available sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2FE-ABE8e-SpRY
Plasmid#213008PurposeA lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning siteDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralTagsExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pABE8e-NG-403Q-Nterm-AAV
Plasmid#194651PurposeN-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in miceDepositorInsertABE8e-NG N-term
UseAAVTagsBPNLS and NpuN spilt inteinExpressionMutationPromoterTNNT2Available sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pABE8e-NG-403Q-Cterm-AAV
Plasmid#194652PurposeC-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in miceDepositorInsertABE8e-NG C-term
UseAAVTagsBPNLS and NpuC split inteinExpressionMutationPromoterTNNT2Available sinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 promoter for crRNA expression and EFS promoter…Available sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS1964 All-in-one AAV-U1a-NmeABE-8e-2xBPSV40-miniU6-Rosa26
Plasmid#199262PurposeSingle AAV vector for expressing N-terminal fusion Nme2Cas9-ABE8e and one miniU6 driven sgRNA targeting mouse Rosa26 geneDepositorInsertNmeABE8e
UseAAV and CRISPRTagsNLSExpressionMammalianMutationPromoterU1aAvailable sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgExpressionMutationTruncation of the signaling domainPromoterEF1aAvailable sinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-HygR-EGFP
Plasmid#167188PurposeLentiviral expression of sgRNA with hygromycin resistance gene and EGFPDepositorInsertHygromycin B phosphotransferase and EGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCKO
Plasmid#73311PurposeLentiviral backbone for cloning and expressing U6 driven sgRNAs with BfuAI cloning sites and puromycin selection.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051_dCas9-KRAB-HA
Plasmid#228936PurposeAll-in-one dCas9-KRAB-MeCP2 plasmid for cloning of custom sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable sinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only