We narrowed to 11,495 results for: ANG
-
Plasmid#229711PurposeStable transformation or transient expression of gene of interest in plantsDepositorInsertDM3(Hh-0) (AT3G61540 Mustard Weed)
ExpressionPlantAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(Y86C)-GFP
Plasmid#246840PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with Y86C mutationDepositorInsertArl13B (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationchanged Tyrosine 86 to CysteineAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(R79Q)-GFP
Plasmid#246839PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with R79Q mutationDepositorInsertArl13B (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationchanged Arginine 79 to GlutamineAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
ARL13B-(C8C9- SS)-GFP
Plasmid#246842PurposeExpress Arl13B (resistance to sgRNA), tagged with GFP, with C8C9-SS mutationDepositorInsertArl13B (ARL13B Human)
UseLentiviralTagsGFPExpressionMammalianMutationchanged Cysteine 8 and 9 to SerineAvailable SinceDec. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p15GFPkv
Plasmid#239039PurposeExpresses a + positively charged GFP variant (+15GFPKv) in mammalian cellsDepositorInsertp15GFPKv-NES
ExpressionMammalianMutationAll surface-exposed Arg residues changed to LysinePromoterCMVAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hVAMP3(1-77) S44E
Plasmid#206030PurposeExpresses the SNARE motif of human VAMP3 mutant S44E in bacteriaDepositorInsertVesicle-associated membrane protein 3 (VAMP3 Human)
Tagshis-tagExpressionBacterialMutationchanges serine 44 to glutamic acidPromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP15022 - pAAV-AiE1398m-minBG-SYFP2-P2A-3XFLAG-H2B-WPRE3-BGHpA
Plasmid#243314PurposeAiE1398m is an enhancer sequence designed to drive AAV-mediated transgene expression in specific populations of brain cells.DepositorInsertSYFP2-P2A-3XFLAG-H2B
UseAAVAvailable SinceSept. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
ACE2-Mutant-R671A
Plasmid#240606PurposeTo test ACE2 cleavage by TMPRSS2. This protease targets R and K amino acids of ACE2; R was substituted by A at Residue 671 of ACE2 in the collectrin-like siteDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
TagsFLAG tagExpressionMammalianMutationArginine (R) at position 671 on ACE2 is replaced …PromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-TAZ-CAMTA1
Plasmid#235681PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Podxl S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNDGG006
Plasmid#231310PurposeVector part for BEVA; BEVA2.0 Position 3 p15A narrow host range origin of replication with oriT, CmR.DepositorInsertBEVA2.0 Position 3 p15A narrow host range origin of replication with oriT, CmR.
ExpressionBacterialAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACYCDuet-1:ChrA-C63S-C66S
Plasmid#225082PurposeExpresses precursor peptide ChrA-C63S/C66S in E.coliDepositorInsertChrA-C63S/C66S
TagsHis6ExpressionBacterialMutationC63S/C66SPromoterT7Available SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-MYC-Guide-hSpCas9
Plasmid#228574PurposeExpression of human MYC gRNA; CRISPR mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-TGFa-mNeonGreen
Plasmid#209913PurposeTo monitor the expression of TGFα, the plasmid encodes a recombinant TGFα fused intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-mNeonGreen
Plasmid#209914PurposeTo monitor the expression of Epiregulin, the plasmid encodes a recombinant Epiregulin fused intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-PLK4
Plasmid#227310PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of PLK4 for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLYS6-METTL17-LYRMut-FLAG
Plasmid#220877PurposeExpressing METTL17-LYRMut-FLAGDepositorInsertMETTL17 (METTL17 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationChanged the LYP domain to AAAAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4807
Plasmid#215273PurposeModule for the expressino of the N. nambi HISPS gene under the PNOS promoter and the constitutive expression of EGFP and p19.DepositorInsertPNOS:HISPS-SF-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only