We narrowed to 2,745 results for: EXO
-
Plasmid#147216PurposeInsect Expression of DmDCP1-Y34A-dsRNAresDepositorInsertDmDCP1-Y34A-dsRNAres (Dcp1 Fly)
ExpressionInsectAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnYC-NvHN-DmXRN1_1323-1355_N
Plasmid#147052PurposeBacterial Expression of DmXRN1_1323-1355DepositorInsertDmXRN1_1323-1355 (pcm Fly)
ExpressionBacterialAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_Camk2a sgRNA / hSpCas9
Plasmid#172839PurposeMammalian expression of a sgRNA targeting the intron 17 (last intron) of Camk2a (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 17 of Camk2a under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i5 sgRNA / hSpCas9
Plasmid#172829PurposeMammalian expression of a sgRNA targeting the intron 1 position 5 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i3 sgRNA / hSpCas9
Plasmid#172827PurposeMammalian expression of a sgRNA targeting the intron 1 position 3 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i2 sgRNA / hSpCas9
Plasmid#172826PurposeMammalian expression of a sgRNA targeting the intron 1 position 2 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGxxFP-PIGA
Plasmid#153958PurposeUsed for EGxxFP assay with PIGA intron 5 and exon 6 sequencesDepositorInsertPIGA (a 401-bp fragment from intron 5 and exon 6)
UseA plasmid specific for egxxfp assayTagsN/AExpressionMammalianMutationNo mutationPromoterCAG promoterAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-Neo-p53mut
Plasmid#99239PurposeMutant p53 encoded by AS-30D rat hepatoma cell lineDepositorInsertp53 (Tp53 Rat)
ExpressionMammalianMutationSilent mutations in translated protein at Gly (10…PromoterCMV immediate/early enhancer/promoterAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-SPA mimic WT
Plasmid#92350PurposeTo mimic SPA RNA processing and expressionDepositorInsertSNRPN exon 9, intron9, exon10, intron10 partial partial of SPA1 (SNRPN Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Hy_pMT Laccase2 MCS-Laccase2 608-1097
Plasmid#69890PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorInsertLaccase2 (stw Fly)
ExpressionInsectMutationL158I in laccase2PromoterMetallothionein Promoter (pMT)Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMA3411
Plasmid#46877PurposeA retroviral vector for the constitutive expression of soluble guanylate cyclase1 beta3 double mutant (E473K and C541D)DepositorInsertsoluble guanylate cyclase1 beta 3 (Gucy1b3 Rat)
UseRetroviralMutationE473K, C541DPromoterLTRAvailable SinceAug. 14, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE5
Plasmid#169267PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 5DepositorInsertRBM28 delta E5 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE8
Plasmid#169268PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 8DepositorInsertRBM28 delta E8 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
polyQ74-GFP
Plasmid#231893PurposeForms cytosolic HTT partial exon 1 Q74 aggregatesDepositorInsertHTT partial exon 1 Q74 (HTT Human)
TagsEGFPExpressionMammalianMutationCAG repeat expansionAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaV1.3e[8a,11,31b,Δ32,42a]
Plasmid#49333PurposeRepaired Addgene #26576 to agree with the rat ref sequence. Repairs are @: nt 3310 (GTG->GCG) [Val->Ala]; nt 731 (TCA->GGA) [Ser->Gly].DepositorInsertCACNA1D (Cacna1d Rat)
ExpressionMammalianMutationContains exons 8a, 11, 31b and 42a.Deletion of ex…PromoterCMVAvailable SinceFeb. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-polyQ23-NLS
Plasmid#231891PurposeExpression of non-aggregated HTT partial exon 1 Q23-NLS in the nucleusDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1-SF2
Plasmid#99020PurposeBacterial expression of SF2DepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKT2/CAGXSP/GFPCD63
Plasmid#231709PurposeStably express CD63 fused with GFP in mammalian cells via the sleeping beauty transposon system.DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3xHA-eGFP-OMP25
Plasmid#239249Purpose3xHA-eGFP-OMP25 lentiviral overexpression vectorDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA1-Tat
Plasmid#138478PurposeExpresses HIV Tat for efficient sgRNA packaging.DepositorInsertTat
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Hsa
Plasmid#128175PurposeDoxycyclin inducible shRNA knockdown of human cGAS geneDepositorAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-MRE11-H63D
Plasmid#82036PurposePlasmid for constitutive or doxycycline-inducible expression of H63D exonuclease-dead mutant of human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorInsertMRE11 (MRE11 Human)
TagsHAExpressionMammalianMutationExonuclease-dead mutant: H63D MRE11PromoterCMV-tetAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
EPS15-GFP-His
Plasmid#170860PurposeMammalian expression of EPS15-GFP-His.DepositorInsertEpidermal growth factor receptor pathway substrate 15 (EPS15) (EPS15 Human)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag-Msi1
Plasmid#184029PurposeMsi1 clone with N-terminal flag tagDepositorAvailable SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG_iPE-N
Plasmid#214734Purposeencodes iPE-N prime editor (with MMLV-RT(H8Y, D200N, T306K, W313F, T330P, L603W) fused to the N terminus of nCas9-H840A) driven by a CAG promoterDepositorInsertCAG_iPE-N_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-shRab27a
Plasmid#120930Purposeconditionally knockdown Rab27a in mouse cell linesDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG_iPE-C
Plasmid#214735Purposeencodes iPE-C prime editor (with MMLV-RT(H8Y, D200N, T306K, W313F, T330P, L603W) fused to the C terminus of nCas9-N863A) driven by a CAG promoterDepositorInsertCAG_iPE-C_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti hSyn HK1
Plasmid#220915PurposeNeuronal specific expression of HK1DepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
ER-CanlonicSF
Plasmid#178343PurposeTo explore endoplasmic reticulum lactate dynamicsDepositorInsertER-CanlonicSF
TagsER Retention Signal, ER Signal Exon 1, and ER Sig…ExpressionMammalianPromoterCMVAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SF3B1-K700E-reporter
Plasmid#200318PurposeA fluorescent reporter for SF3B1 K700E mutation. Co-expresses a blasticidin resistance gene for selection. Includes LoxP sites for Cre-mediated deletion of reporter cassette.DepositorInsertBSD-2A-EGFPi
UseLentiviralExpressionMammalianPromoterEF1-aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBbiRP Hu Full Length CD142 (Tissue Factor; F3)
Plasmid#183254PurposeExpression of full length human tissue factor (CD142; F3) in a Sleeping Beauty transposon vectorDepositorInsertTissue factor (F3 Human)
ExpressionMammalianAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
WDFY2-GFP
Plasmid#193636PurposeExpresses GFP-tagged WDFY2 in mammalian cellsDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shcGAS-Mmu
Plasmid#127698PurposeDoxycyclin inducible shRNA knockdown of mouse cGAS geneDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2-VSV
Plasmid#139344PurposeExpression of TYK2 proteinDepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ shIFNAR
Plasmid#127699PurposeDoxycyclin inducible shRNA knockdown of mouse IFNAR geneDepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TPST1-EGFP
Plasmid#66617PurposeEncodes GFP fusion of TPST1 trans Golgi marker; (Tyrosyl protein sulfotransferase 2)DepositorInsertTPST1 (TPST1 Human)
ExpressionMammalianAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
SuExp-hPLD4
Plasmid#201244Purposeexpress full length human PLD4 proteinDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only