We narrowed to 1,625 results for: PREP
-
Plasmid#165088Purposeprotein expression in E. coliDepositorInsertSevere acute respiratory syndrome coronavirus 2 ORF3b (S23Q)
ExpressionBacterialMutationStop codon to glutamine at 23rd amino acidAvailable SinceFeb. 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-ZNF207-3xFLAG
Plasmid#231939PurposeVector for generating stable lines allowing expression of ZNF207-3xFLAGDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET24+ CUL5(1-384)
Plasmid#246504PurposeRecombinant protein expression of CUL5(1-384)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZNpF-∆48∆11
Plasmid#245369PurposeDual luciferase (nano, firefly) with Zfp423 5' end fused to NanoLuciferaseDepositorInsertZfp423-∆48∆11 (Zfp423 Mouse)
UseLuciferase and Synthetic BiologyTagsNanoLuciferaseExpressionMammalianMutation11-bp deletion, H96Wfs*4, plus synthetic 48-bp up…PromoterEF1aAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVBL0001
Plasmid#242429PurposeStable genomic integration of Opto-IRE1 (HsIRE1dLD-mCherry-CRY2clust) using the Flp-in system.DepositorInsertIRE1alpha (ERN1 Human)
TagsmCherry, CRY2clustExpressionMammalianMutationDeletion of the lumenal domainPromoterCMV, tet-inducibleAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD D262V
Plasmid#234607PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 D262V LCD (186-320)DepositorInserthnRNPA1_LCD_D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD D262N
Plasmid#234608PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 D262N LCD (186-320)DepositorInserthnRNPA1_LCD_D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3G1S+4V
Plasmid#234612PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 Gly and 1 Ser mutated to AsnDepositorInserthnRNPA1_LCD_4GSV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationG204V, S231V, G274V, G303VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 5W D262V
Plasmid#234617PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_5W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF222W, F228W, Y237W, D262V, Y305W, F320WPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521A-peGFP-N1
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only