We narrowed to 15,548 results for: LEA
-
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-66Q-myc-WPRE
Plasmid#107934PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of mutant HTT (mHTT, 66 polyQ repeats) in neuronsDepositorInsertExon 1 of mutant HTT, 66 polyQ repeats (HTT Human)
UseAAVTagsExpressionMutationPromoterhSynapsinAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-3*Flag-APEX2 C-term EWSR1
Plasmid#187586PurposeExpress FLAG epitope and APEX2-tagged EWSR1 fusion protein in mammalian cellsDepositorInsertEWSR1 (EWSR1 Human)
UseTagsAPEX2-FLAGExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable sinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC293 - pAAV EF1a V5-synuclein (WT)
Plasmid#60057PurposeAn AAV packaging vector that expresses wildtype alpha-synuclein under control of the EF1a promoter.DepositorInsertalpha-synuclein (SNCA human, Human)
UseAAVTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1-cofilin
Plasmid#186750PurposeExpresses wildtype mCherry-tagged human cofilin in mammalian cellsDepositorInsertCofilin-1 (CFL1 Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Human 3' HP1a AID GFP PuroR
Plasmid#127906PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a GeneDepositorInsertHP1 (CBX5 Mustard Weed, Human)
UseDonor plasmidTagsGFP, AID, PuroRExpressionMutationInserting GFP AID 2A Puro into mouse 3' Hp1aPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
UseTagsExpressionMammalianMutationPromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12/Cyclin K
Plasmid#231730PurposeProtein expression in insect cellsDepositorUseTagsFlag-3CExpressionInsectMutationPromoterAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK13/Cyclin K
Plasmid#231731PurposeProtein expression in insect cellsDepositorUseTagsFlag-3CExpressionInsectMutationPromoterAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti GW V5 Eco/Dam hum LaminB1
Plasmid#182671PurposeEukaryotic expression vector with E.Coli Dam methylation fused to human Lamin B1. Used in DamID experiments to methylate DNA that interacts in the proximity of Lamin B1.DepositorInsertLamin B1 (LMNB1 Human)
UseLentiviralTagsE. Coli Dam and V5ExpressionMammalianMutationPromoterHSPAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGF13A
Plasmid#220793PurposeTo express the human FGF13 isoform 1(FGF13A) in mammalian cells together with EGFPDepositorInsertFGF13 (FGF13 Human)
UseTagsExpressionMutationPromoterAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE
Plasmid#125713PurposeCre-dependent vector expressing an optimized mosquito OPN3 rhodopsin in-frame with mScarletDepositorHas ServiceAAV1 and AAV5InserteOPN3
UseAAV and Cre/LoxTagsRho1D4 and mScarletExpressionMammalianMutationdeleted amino acids 331-429PromoterhSyn1Available sinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
Plasmid#210513Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON and SEAP reporter in mammalian cellsDepositorInsertssecreted alkaline phosphatase
CMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
UseTagsMycExpressionMammalianMutationPromoterCMV and TetOAvailable sinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-UBnc-PURO
Plasmid#208037PurposeEnables inducible expression of C-terminal Split-TurboID-fused UBnc, to perform Ubiquitin-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertUbnc (UBC Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDExpressionMutationL73P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable sinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
UseTagsExpressionMammalianMutationPromoterChicken bactin (plus Chicken bactin intron)Available sinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-7xTRE-3xeGFP
Plasmid#191206PurposeGFP expression under the control of TRE promotorDepositorInsert3X GFP
UseAAVTagsExpressionMammalianMutationPromoterTREAvailable sinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseTagsExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…PromoterAvailable sinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX--DmrB-DmrB-Ripk3(deltaC)-2A-mCherry-puro
Plasmid#231973PurposeTet inducible expression of DmrB-Ripk3 with mCherry to induce Ripk3 necroptosisDepositorInsertRipk3-deltaC dimerizing construct with bi-cistronic mCherry (Ripk3 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only