We narrowed to 10,162 results for: tre promoter
-
Plasmid#104957PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila germline tissues using Gal4 driversDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pDSM-de-Pfba1-PYC-Trpl15a
Plasmid#127738PurposeYeast pathway position 5. PYC transcription unit with the FBA1 promoter and RPL15A terminator.DepositorInsertpyruvate carboxylase (PYC1 Budding Yeast, Synthetic)
UseSynthetic BiologyExpressionYeastPromoterPfba1Available SinceJan. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASt-FMW-attB-AthHen1
Plasmid#104958PurposeExpression of FLAG Myc tagged A.thaliana-Hen1 (codon optimised for Drosophila) in Drosophila using somatic tissue Gal4 driversDepositorAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-
-
pSG059
Plasmid#214262PurposePaFtsH2-6xHis cloned in XbaI/NheI site in pET-28a(+)DepositorInserttLST accessory element PaFtsH2 protease of Pseudomonas aeruginosa SG17M
Tags6x His-tag and 6xHis-tagExpressionBacterialPromoterT7 promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
10X PRE TK luc
Plasmid#206162PurposeLuciferase reporter construct containing 10 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert10X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
8X PRE TK luc
Plasmid#206161PurposeLuciferase reporter construct containing 8 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert8X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
6X PRE TK luc
Plasmid#206160PurposeLuciferase reporter construct containing 6 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert6X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW pHluorin-SYT9 IRES mRuby3
Plasmid#195698PurposeLentiviral plasmid encoding SYT9 with an N-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Syt9 IRES mRuby3
Plasmid#195700PurposeLentiviral plasmid encoding full-length mouse SYT9 followed by an internal ribosomal entry site followed by mRuby under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
1BR9-AtWUSSTOP
Plasmid#202053PurposeE. coli expression vector for N-ter GFP11 tagged Arabidopsis thaliana WUSCHELDepositorInsertAtWUS E. Coli Codon Optimized (WUS Mustard Weed)
Tags6xHis and GFP11ExpressionBacterialPromoterT7 PromoterAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only