We narrowed to 8,858 results for: sgRNA
-
Plasmid#158250PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone1
Plasmid#162128PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgTK
Plasmid#122852PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK geneDepositorInsertsCas9-GFP
U6-sgTK
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgAMPKa1
Plasmid#138684PurposeExpresses a human AMPKa1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV312.3
Plasmid#119944PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cellsDepositorInsertC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceMay 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianPromoterEF1aAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-haA3A-CBE-G-C
Plasmid#220899PurposeAAV genome encoding the C-terminal of haA3A-CBE-G, and sgRNADepositorInserthaA3A-CBE-G-C
UseAAVExpressionMammalianAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgUPRT
Plasmid#122853PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT geneDepositorInsertsCas9-GFP
U6-sgUPRT
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE C-terminal
Plasmid#137183PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-saCBE C-terminal
UseAAVPromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-BaeI-Pgk-Cre
Plasmid#173663PurposeVector with BaeI site to allow cloning of custom sgRNA into vector containing Cre-recombinaseDepositorInsertBaeI site
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7748 mU6: Spy sgTET || CMV: mCherry~P2A-DD-A4
Plasmid#123657PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control with sgRNA driving TRE3G activation.DepositorInsertmCherry-P2A-DD-AcrIIA4
UseCRISPR, Lentiviral, and Synthetic BiologyTagsmCherry-P2AExpressionMammalianPromoterCMV and mU6Available SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgVRK1
Plasmid#199638PurposeTamoxifen-inducible expression of sgRNA targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.FLAG.VSVg_NGFR
Plasmid#158233PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only