We narrowed to 8,909 results for: sgRNA
-
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-ABE C-terminal
Plasmid#137178PurposeAAV genome: expresses the C-terminal of v5 AAV-ABE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVPromoterCMVAvailable SinceJan. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.EFS.SpCas9.P2A.BSD
Plasmid#57821PurposeLentiviral Vector for SpCas9 Expression without sgRNA, Blasticidin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSJX022
Plasmid#232325PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PvanAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.VSVg_NGFR
Plasmid#158241PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2FE-ABE8e-SpRY
Plasmid#213008PurposeA lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning siteDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE N-terminal
Plasmid#137175PurposeAAV genome: expresses the N-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE N-terminal; U6-protospacer
UseAAVMutationCas9 D10APromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSJX023
Plasmid#232326PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and sfGFPExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSJX024
Plasmid#232327PurposeGenome editing in Caulobacter crescentusDepositorInsertssgRNA
SpCas9M
UseCRISPRTagsH-arms and catExpressionBacterialPromoterPJ23119 and PxylAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD
Plasmid#169818PurposeExpresses C-terminal flag-tagged CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCCC -> AGTC silent mutations at nt527-530 eli…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-CBE C-terminal
Plasmid#137176PurposeAAV genome: expresses the C-terminal of v5 AAV-CBE from the Cbh promoter, and U6-sgRNADepositorInsertv5 AAV-CBE C-terminal; U6-protospacer
UseAAVPromoterCbhAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-PE3 HEK3
Plasmid#206273PurposeVector for the production of recombinant baculovirus using MultiMate assembly. All-in-one vector for PE3 HEK3 prime editing.DepositorInsertPE2 (synthetic), hU6 HEK3 PegRNA, hU6 HEK3 sgRNA, aeBlue (E. quadricolor), VSV-G, TagBFP
UseCRISPR; Recombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051_dCas9-KRAB-HA
Plasmid#228936PurposeAll-in-one dCas9-KRAB-MeCP2 plasmid for cloning of custom sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-pU6-(BbsI)-CcdB-(BbsI)-Pgk-Puro-T2A-BFP
Plasmid#86457PurposeMouse stem cell retroviral vector including a puromycin resistance and BFP gene. sgRNA targets can be cloned in between the BbsI sitesDepositorInsertBFP
UseCRISPRExpressionMammalianPromoterPgkAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR-v2-HygR-EGFP
Plasmid#167188PurposeLentiviral expression of sgRNA with hygromycin resistance gene and EGFPDepositorInsertHygromycin B phosphotransferase and EGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pABE8e-NG-403Q-Nterm-AAV
Plasmid#194651PurposeN-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in miceDepositorInsertABE8e-NG N-term
UseAAVTagsBPNLS and NpuN spilt inteinPromoterTNNT2Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pABE8e-NG-403Q-Cterm-AAV
Plasmid#194652PurposeC-terminal AAV genome plasmid encoding ABE8e + sgRNA to correct the R403Q mutation in miceDepositorInsertABE8e-NG C-term
UseAAVTagsBPNLS and NpuC split inteinPromoterTNNT2Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST Halo-flag-CAD
Plasmid#188117PurposeExpresses N-terminal Halo-tagged/C-terminal flag-tagged human CAD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tag and Halo tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgGabbr1
Plasmid#240044PurposeKnockdown expression of Gabbr1DepositorInsertgamma-aminobutyric acid type B receptor subunit 1 (Gabbr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterCMVAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only