We narrowed to 121 results for: SHH
-
Plasmid#122290PurposeKnockdown for mouse Hmga2DepositorAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV mouse Vav1DN IRES GFP
Plasmid#107092PurposeMammalian expression retroviral vectorDepositorInsertVav1 dominant negative cDNA (Vav1 Mouse)
UseRetroviralExpressionMammalianMutationAA 1-186Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMTK_063-Soff-3ShHSP17.2
Plasmid#255414Purpose3'UTR from Saccharum officinarum x spontaneum Heat shock 17.2kDa protein for tunable gene expression in monocotsDepositorInsert3ShHSP17.2
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMTK_064-Soff-3ShHSP17.9
Plasmid#255415Purpose3'UTR from Saccharum officinarum x spontaneum Heat shock 17.9kDa protein for tunable gene expression in monocotsDepositorInsert3ShHSP17.9
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMTK_065-Soff-3ShHSP70
Plasmid#255416Purpose3'UTR from Saccharum officinarum x spontaneum Heat shock 70kDa protein for tunable gene expression in monocotsDepositorInsert3ShHSP70
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1(#c)
Plasmid#206359PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA of Hsp90ab1 (#c)
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-shHsp90ab1 (#a)
Plasmid#206357PurposeAAV plasmid expressing HSP90AB1 shRNA in photoreceptorsDepositorInsertshRNA #a of Hsp90ab1
UseAAVPromoterhuman red opsinAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM mir shHoxB9 a
Plasmid#27021DepositorInsertmir HoxB9 2A
UseRNAi and RetroviralExpressionMammalianAvailable SinceJan. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
XE160 XDshHA-pt mutant PDZ-CS2+
Plasmid#16780DepositorInsertDishevelled (dvl2.L Frog)
UseXenopus expressionTagsHAMutationpoint mutation in the binding pocket of the PDZ b…Available SinceMarch 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
XE161 XDshHA-triple pt mutant-CS2+
Plasmid#16779DepositorInsertDishevelled (dvl2.L Frog)
UseXenopus expressionTagsHAMutationtriple point mutation outside of the PDZ binding …Available SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ-TniQ)-sgRNA_entry (CJT112)
Plasmid#181791PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShHELIX(Cas12k-TniQ)-sgRNA_entry (CJT111)
Plasmid#181790PurposeExpresses 3-component ShHELIX containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShTnsB, ShTnsC, ShCas12k-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(E167)
Plasmid#166004PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(E167)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(D165)
Plasmid#166003PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(D165)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(C164)
Plasmid#166002PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(C164)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET19b-rShHTL7 cPGFP(L166)
Plasmid#165995PurposeExpression of coding sequence in Escherichia coliDepositorInsertrShHTL7 cPGFP(L166)
ExpressionBacterialPromoterT7 promoterAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQE80L-IL2 C125S
Plasmid#104348PurposeExpresses human IL-2 (C125S)DepositorInsertHuman IL-2 (C125S) (IL2 Human)
TagsMRGSHHHHHGS-tagExpressionBacterialMutationC125S mutation (TGT -> TCC)PromoterT5Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only