We narrowed to 148 results for: mKO2
-
Plasmid#242592PurposeA CAGGS driven expression vector containing FastFUCCI to label cell cycle state.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterCAGGSAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-FastFUCCI-IRES-myr-mTagBFP (JDW 1502)
Plasmid#242597PurposeA CAGGS driven expression vector containing FastFUCCI to label cell cycle state followed by an IRES and a membrane targeted mTagBFP2DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterCAGGSAvailable sinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19 KGA HA5'-mKO2-P2A-Zeo-3'
Plasmid#110408PurposeHomology donor for glutaminase KGA isoform knock-in, mKO2-P2A-ZeoDepositorAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mKO2-Parkin
Plasmid#213544PurposeTransient mammalian expresssion of Parkin, N-terminally tagged with mKO2, M1 of Parkin intactDepositorAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKO2-CDK4
Plasmid#215065PurposeExpresses mKO2-CDK4 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKO2-CDK6
Plasmid#215066PurposeExpresses mKO2-CDK6 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(K161N)-A92mKO2
Plasmid#213554PurposeLentiviral vector for stable expression of K161N Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationK161N mutation in ParkinPromoterEF1aAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(S65A)-A92mKO2
Plasmid#213557PurposeLentiviral vector for stable expression of S65A Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationS65A mutation in ParkinPromoterEF1aAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pME-FastFucci-P2A-H2A-tdiRFP (JDW 1399)
Plasmid#242557PurposeGateway middle entry clone containing mammalian FastFUCCI reporter followed by H2A tdiRFP reporter; For visualizing cell cycle state. tdiRFP reporter labels all cells regardless of cell cycle stateDepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
UseGateway CloningAvailable sinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-FastFUCCI-IRES-myr-mKate2 (JDW 1503)
Plasmid#242598PurposeA CAGGS driven expression vector containing FastFUCCI to label cell cycle state followed by an IRES and a membrane targeted mKate2DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterCAGGSAvailable sinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Parkin(C431N)-A92mKO2
Plasmid#213545PurposeTransient mammalian expresssion of ligase-dead C431N Parkin, internally tagged with mKO2DepositorAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
KA2880_pPB-TREtight-FLAG-Esrrb-InO
Plasmid#124178PurposepiggyBac-based Dox-inducible expression of FLAG-EsrrbDepositorAvailable sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(R104A)-A92mKO2
Plasmid#213556PurposeLentiviral vector for stable expression of R104A Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationR104A mutation in ParkinPromoterEF1aAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-CMV(trunc)-Parkin-A92mKO2
Plasmid#213549PurposeLentiviral vector for stable low expression of Parkin, internally tagged with mKO2DepositorAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(N273K)-A92mKO2
Plasmid#213555PurposeLentiviral vector for stable expression of N273K Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationN273K mutation in ParkinPromoterEF1aAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLv-EF1a-Parkin(W403A)-A92mKO2
Plasmid#213558PurposeLentiviral vector for stable expression of W403A Parkin, internally tagged with mKO2DepositorInsertParkin (PRKN Human)
UseLentiviralExpressionMammalianMutationW403A mutation in ParkinPromoterEF1aAvailable sinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
KA2944_pPB-TREtight-Esrrb-FLAG-InO
Plasmid#124179PurposepiggyBac-based Dox-inducible expression of Esrrb-FLAGDepositorAvailable sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
mKO2-Caveolin-C-10
Plasmid#57859PurposeLocalization: Membrane, Excitation: 551, Emission: 565DepositorAvailable sinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by