We narrowed to 2,263 results for: EXO
-
Plasmid#207455Purposein vitro transcription of mRNADepositorInsertH840A
ExpressionBacterialAvailable SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-HKDC1
Plasmid#23613DepositorInsertHKDC1 (HKDC1 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TetO-U1-70K-fSNAPc
Plasmid#106987Purposeopen reading frame of U1-70K inserted into pcDNA5-FRT-TetO-fSNAPc using the KpnI and NotI restriction sitesDepositorInsertU1-70K (SNRNP70 Human)
TagsfSNAPAvailable SinceJune 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miRE-shRNA IFT88-PGK-neo-IRES-GFP
Plasmid#73576PurposeMammalian retroviral expression vectorDepositorAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag HK3
Plasmid#20414DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-NPM1c
Plasmid#131813PurposeExpresses Flag-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsFLAGExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
EPS15-GFP-His
Plasmid#170860PurposeMammalian expression of EPS15-GFP-His.DepositorInsertEpidermal growth factor receptor pathway substrate 15 (EPS15) (EPS15 Human)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRET.IL.IRES-EGFP (No HSV-TK)
Plasmid#1836DepositorTypeEmpty backboneUseCre/Lox and RetroviralExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCAG_iPE-N
Plasmid#214734Purposeencodes iPE-N prime editor (with MMLV-RT(H8Y, D200N, T306K, W313F, T330P, L603W) fused to the N terminus of nCas9-H840A) driven by a CAG promoterDepositorInsertCAG_iPE-N_bGH
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1c-C1
Plasmid#131821PurposeExpresses HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
TagsHcRedExpressionMammalianMutationThis is the cytoplasmic mutant causing AML, where…Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-A
Plasmid#64513PurposeAS-30D hepatoma hexokinase II 4.3 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-C
Plasmid#64515PurposeAS-30D hepatoma hexokinase II 2.1 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2-VSV
Plasmid#139344PurposeExpression of TYK2 proteinDepositorAvailable SinceApril 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
VAMP2-SNAPtag
Plasmid#107372PurposeSynaptic vesicle protein VAMP2 fused to the SNAPtag domainDepositorAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB2-SA(1)-T2A-Gal4
Plasmid#62900PurposeCreating Gal4 drivers from MiMIC lines with inserts into coding introns in Phase 1DepositorInsertT2A-Gal4
Available SinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-EGFP
Plasmid#209057PurposeGateway-compatible entry vector, with insert of the EGFP geneDepositorInsertEGFP
UseGateway CloningExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC-(loxP2-attB2-SA(1)-T2A-Gal4-Hsp70)
Plasmid#62955PurposeSinglet donor (phase 1) for in vivo RMCE with MiMIC inserts to make Gal4 driver.DepositorInsertT2A-Gal4-Hsp70
Available SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
TFORF2400
Plasmid#144335PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
SF-U7snRNA-CypA-E4
Plasmid#190695PurposeControl vector expressing a U7-based antisense oligonucleotide targeting CypA exon 4DepositorInsertU7 snRNA antisense CypA Exon 4
UseLentiviralExpressionMammalianPromoterU7 promoterAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only