We narrowed to 2,128 results for: Pam
-
Plasmid#222592PurposeBB2 gsdA tet-on overexpression cassetteDepositorArticleInsertgsdA
ExpressionBacterialMutationInternal BsaI and BpiI sites removed from insert,…Promotertet-onAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a ActBT2ATetP2AP - mAGH
Plasmid#229973PurposeHarbor sgRNA+PAM sequence of ActinB gene for knockin using CRISPR and Homology Independent Targeted Integration. Contains last ActB exon fused T2A-tet regulatory elemeny-P2A-puro and mAGNLS-T2A-HygroDepositorInsertActBT2ATetP2AP - mAGH
UseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a ActBT2ATetP2AP - H
Plasmid#229972PurposeHarbor sgRNA+PAM sequence of ActinB gene for knockin using CRISPR and Homology Independent Targeted Integration. Contains last ActB exon fused T2A-tet regulatory elemeny-P2A-puro and HygroDepositorInsertActBT2ATetP2AP - H
UseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
psBIG1a ActBT2AmcherryP2AP -TagBFPH
Plasmid#229971PurposeHarbor sgRNA+PAM sequence of ActinB gene for knockin using CRISPR and Homology Independent Targeted Integration. Contains Last ActB exon fused T2A-mCherry-P2A-puro and mTagBFPnls-T2A-HygroDepositorInsertActBT2AmcherryP2AP -TagBFPH
UseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCB591
Plasmid#141096PurposeE. coli-Lactobacilli shuttle vector for recombineering template cloningDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
p458 VQR
Plasmid#101727PurposeExpresses a sgRNA and a Cas9 VQR variant that recognizes "NGA" PAM motifsDepositorInsertSpCas9 VQR
ExpressionMammalianMutationVQRAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-SPNM-B
Plasmid#48661PurposeBacterial SP and NM repression YFP reporter: protospacer BDepositorInsertSP/NM prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
px459 EQR
Plasmid#101732PurposeExpresses a sgRNA and a Cas9 EQR variant that recognizes "NGAG" PAM motifsDepositorInsertSpCas9 EQR
ExpressionMammalianMutationVQRAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-A
Plasmid#48665PurposeBacterial ST1 repression YFP reporter: protospacer ADepositorInsertST1 prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKO023
Plasmid#242923PurposeReporter J1-J3(122)-BBa_J23117 with Sth1 PAMDepositorInsertJ1-J3(122)
UseCRISPR and Synthetic BiologyPromoterBba_J23117Available SinceSept. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL1_3
Plasmid#199035PurposeLevel 1 plasmid, barcoded ORIDepositorInsertpAM?1 ORI plus NGS barcode 3
UseSynthetic BiologyAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-NM-A
Plasmid#48664PurposeBacterial NM repression YFP reporter: protospacer ADepositorInsertNM prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-A
Plasmid#48666PurposeBacterial TD repression YFP reporter: protospacer ADepositorInsertTD prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-DTR-GFP
Plasmid#124364Purposeconditional expression of a diphtheria toxin receptor (DTR)–GFP fusion proteinDepositorHas ServiceAAV2InsertDTR-GFP
UseAAVTagsGFPPromoterChicken B-actinAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only