We narrowed to 3,400 results for: cmv promoter
-
Plasmid#62158PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and iRFP module. Compatible with MultiSite Gateway cloningDepositorInsertiRFP
UseMule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR
Plasmid#204146PurposeLentivirus backbone with BA.1 spike under an inducible promoter and constitutive expressed zsGreen-T2A-PuR genesDepositorInsertsSARS-CoV-2 BA.1 variant spike
zsGreen-T2A-PuR
UseLentiviralExpressionMammalianMutation21 amino acid cytoplasmic tail deletionPromoterCMV and TRE3GAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE_EXPR_CMV-eGFP_TOP-iRFP_PTCH1-mTurquoise2_CBF-tdTomato
Plasmid#113865PurposeTriple pathway reporter, 3P-Fluor; wnt-iRFP, hedgehog-mTurquoise2, notch-tdTomato; plus CMV-eGFP. Gateway expression vector for lentivirus generation.DepositorInsertsCMV-eGFP
TOP-iRFP
PTCH1-mTurquoise2
CBF-tdTomato
UseLentiviralExpressionMammalianAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDsRed1-CMV-Rat Npas4-DsRed1-pA
Plasmid#233272PurposeTo Express a Rat NPAS4-DsRed fusion protein from a CMV promoterDepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA4-NLS(SV40) (KAC200)
Plasmid#133801PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA4 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA4
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA5-NLS(SV40) (KAC203)
Plasmid#133802PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA5 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA5
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC3-NLS(SV40) (KAC209)
Plasmid#134341PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC3 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC3
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Efa-NLS(SV40) (KAC459)
Plasmid#134337PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EK0379 CMV-TO-EGFP-stop-t70587 (PB)
Plasmid#191154PurposeExpression of Trigger 1 in the 3' UTR of EGFP in mammalian cells; used to make a cell line to study sensors for integrated 3' UTR or CDS triggers; expression is inducible with doxycycline due to CMV-TO promoter.DepositorInsertEGFP-t70587
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA16_Lmo-NLS(SV40) (KAC508)
Plasmid#134332PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA16_Lmo with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA16_Lmo
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC1-NLS(SV40) (KAC208)
Plasmid#134340PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC1
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Efa-NLS(SV40) (KAC91)
Plasmid#134333PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Efa with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Efa
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA17_Sga-NLS(SV40) (KAC92)
Plasmid#134334PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA17_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA17_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sma-NLS(SV40) (KAC95)
Plasmid#134335PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sma with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sma
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Ssim-NLS(SV40) (KAC97)
Plasmid#134336PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Ssim with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Ssim
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA18_Sga-NLS(SV40) (KAC214)
Plasmid#134338PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA18_Sga with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA18_Sga
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA19_Spse-NLS(SV40) (KAC215)
Plasmid#134339PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA19_Spse with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA19_Spse
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIA1-NLS(SV40) (KAC478)
Plasmid#133795PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIA1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIA1
TagsNLS(SV40)ExpressionMammalianMutationn/aPromoterCMV and T7Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKG2438_pGEEC534_pShip-CMV-mRuby2-P2A-PuroR-bGH
Plasmid#239730PurposePlasmid expressing mRuby2 and PuroR with the CMV promoterDepositorInsertmRuby2-P2A-PuroR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only