We narrowed to 2,404 results for: hal.2
-
Plasmid#53174PurposeExpresses HA tagged human ERK2 R67SD321N from blasticidin resistance retroviral vectorDepositorInsertERK2 (MAPK1 Mustard Weed, Human)
UseRetroviralTagsHAExpressionMammalianMutationR67S/D321NAvailable SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-HA-ERK2 K54R
Plasmid#53170PurposeExpresses GST-HA tagged human ERK2 K54R from bacterial expression vectorDepositorAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pWZLblasti-HA-ERK2 R67S
Plasmid#53172PurposeExpresses HA tagged human ERK2 R67S from blasticidin resistance retroviral vectorDepositorAvailable SinceJune 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pWZLblasti-HA-ERK2 D321N
Plasmid#53173PurposeExpresses HA tagged human ERK2 D321N from blasticidin resistance retroviral vectorDepositorAvailable SinceJune 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P12A P13A)
Plasmid#62066PurposeExpression of human p53 (residues 1-73) (P12A, P13A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13APromoterT7Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMAL-PIAL2M-sim1
Plasmid#67908PurposeInducible expression of a mutant of PIAL2M where the SIM interacting motif 1 (VFDL 425-428) was substituted with alanines.DepositorInsertPIAL2 (AT5G41580 Mustard Weed)
TagsMBPExpressionBacterialMutationE281-A496; VEDL 425-428 AAAPromoterP-lacAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (PPP)
Plasmid#62067PurposeExpression of human p53 (1-73) (P12A, P13A, P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13A, P27APromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
HT PTP-RN
Plasmid#24056DepositorAvailable SinceDec. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His Y95F/Y188F/Y426F/Y517F hTFNG hTFNG
Plasmid#70085PurposeExpresses N-His tagged nonglycosylated human serum transferrin unable to bind iron in either the N-lobe or the C-lobeN-lobeDepositorInsertmutated human serum transferrin (TF Human)
TagsHexa His tag and N-terminal signal peptide, 4 aa …ExpressionMammalianMutationAsn413 Asp, Asn611Asp, Tyr95Phe, Tyr188Phe, Ty426…PromoterSV40Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mcherry Gamma 9 in pcDNA3.1
Plasmid#64208PurposemCherry fused between Cry2 and gamma 9 to study cell migrationDepositorTagsmcherry and n/aExpressionMammalianPromoterCMVAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-noTag (in pLEX_307)
Plasmid#214919Purposeconstitutive expression of SRRD with no tag - used as control for SRRD-HA expressionDepositorInsertSRRD (SRRD Human)
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-HA (in pLEX_307)
Plasmid#214918Purposeconstitutive expression of SRRD tagged with HADepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFGC5941-PacI-ath-STTM832-5p
Plasmid#84163Purposetarget miRNA832-5p for destruction in Arabidopsis thalianaDepositorInsertSTTM832-5p
ExpressionPlantPromoter2x35SAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFGC5941-PacI-ath-STTM832-3p
Plasmid#84162Purposetarget miRNA832-3p for destruction in Arabidopsis thalianaDepositorInsertSTTM832-3p
ExpressionPlantPromoter2x35SAvailable SinceDec. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFGC5941-PacI-ath-STTM156/157
Plasmid#84083Purposetarget miRNA156/157 for destruction in Arabidopsis thalianaDepositorInsertSTTM156/157
ExpressionPlantPromoter2x35SAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
actc1b-actn2-mKate2
Plasmid#109751PurposeMuscle specific zebrafish expression of mKate2 fused to alpha actinin 2DepositorInsertalpha actinin 2
UseZebrafish plasmidsTagsmKate2Available SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only