We narrowed to 21,065 results for: ACE
-
Plasmid#195723PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#9 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F23
Plasmid#195737PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#23 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F21
Plasmid#195735PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#21 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET21a Mp-iPGM
Plasmid#180243PurposeBacterial expression plasmid for production of recombinant Mycoplasma pneumoniae iPGM His10DepositorInsertMycoplasma pneumoniae iPGM-10His
TagsHisExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Sa-iPGM-bio
Plasmid#179523PurposeExpresses S. aureus iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertS. aureus iPGM bio-6His
TagsHis tag and biotinylation sequenceExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Mo-iPGM-bio
Plasmid#179614PurposeExpresses M. orale iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertM. orale iPGM bio-6His
TagsHis tag and biotinylation sequenceExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a Hp-iPGM-bio
Plasmid#179615PurposeExpresses H. pylori iPGM containing a C-terminal biotinylation site and His tag in E. coliDepositorInsertH. pylori iPGM bio-6His
TagsHis tag and biotinylation sequenceExpressionBacterialPromoterT7Available SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_CAHS1_PARRC_150-189 (pBS0658)
Plasmid#185201PurposeFor the mammalian expression of the tardigrade protein CAHS1_PARRC_150-189. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertCAHS1_PARRC_150-189
ExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
ExpressionBacterialAvailable SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
ExpressionMammalianMutationA234GAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_93-127 (pBS0735)
Plasmid#185231PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_93-127. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_93-127
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_ANDDA_21-367 (pBS0742)
Plasmid#185234PurposeFor the mammalian expression of the Chinese giant salamander protein APOA4_ANDDA_21-367. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_ANDDA_21-367
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q7JLY3_CAEEL_48-124 (pBS0738)
Plasmid#185232PurposeFor the mammalian expression of the C. elegans protein Q7JLY3_CAEEL_48-124. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ7JLY3_CAEEL_48-124
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
ExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only