We narrowed to 18,004 results for: URE
-
Plasmid#167989Purposeexpression of a nanobody against rat PepT2 as a n terminal MBP fusionDepositorInsertNanobodyD6
TagsHis-MBPExpressionBacterialPromoterpBADAvailable SinceOct. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2369-Tier1-PhCMV_KRAB
Plasmid#169571PurposeTier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).DepositorInsertPCMV-driven Kruppel associated box domain
ExpressionMammalianPromoterPhCMVAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-CBh.22
Plasmid#183566PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated CBh promoter, Fig 3)DepositorInsertAttenuator Sequence 22
ExpressionMammalianPromoterCBhAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-EF1a.13
Plasmid#183576PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated EF1a promoter, Fig 3)DepositorInsertAttenuator Sequence 13
ExpressionMammalianPromoterEF1aAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2341_Tier3(SB)-Puro
Plasmid#169639PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH228-Tier1-OVanO2-PCMVmin2-SEAP
Plasmid#169564PurposeTier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).DepositorInsertvanillic acid-controlled SEAP production
ExpressionMammalianPromoterVanO2-PCMVminAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-F>E
Plasmid#185508PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationF>EAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH1001-Tier2(ColE1 ori)
Plasmid#169599PurposeTier-2 expression vector (A1-pA::A2-pA::A3-pA). The tier-2 expression vector consists of a custom MCS cassette containing the three Tier-1 compatible acceptor cassettes (A1, A2, and A3) each with its own non-homologous polyadenylation (pA) signals in a minimal backbone (AmpR and ColE1 ori).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2351_Tier3(SB)-Zeo
Plasmid#169648PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a ZeoR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-ZeoR-pA-3'ITR)DepositorInsertPRPBSA-driven ZeoR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1040
Plasmid#169618PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1039
Plasmid#169617PurposeTier-2 vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP
ExpressionMammalianPromoterPhCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.7
Plasmid#183581PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 7
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.5
Plasmid#183580PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 5
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.9
Plasmid#183582PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 9
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKDR-TetOn.11
Plasmid#183583PurposeOne in a series of plasmids to titrate levels of expressed protein to levels of endogenous protein (attenuated Tet-On promoter, Fig 3)DepositorInsertAttenuator Sequence 11
ExpressionMammalianPromoterTet-OnAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only