We narrowed to 12,778 results for: NUC
-
Plasmid#228197Purposeexpressed human ADSS with an EGFP fluorescent protein tagDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only
-
-
pU6-hL1-5'_3.3kb plasmid
Plasmid#226006PurposePlasmid used to generate DNA-FISH probe targeting at human L1HSDepositorInsertHuman L1 element 3.3kb sequences at the 5' end
UseSynthetic BiologyAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a11helixDel-sgEIF3D
Plasmid#222135PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-CtermDel-sgEIF3D
Plasmid#222125PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEIF3D-a5helixDel-sgEIF3D
Plasmid#222133PurposeEIF3D variant overexpression vector with sgRNA targeting eIF3DDepositorAvailable SinceOct. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-miRFP670
Plasmid#220600PurposeConstitutive expression of a single-cell discriminating version of miRFP670 fluorescent protein.DepositorInsertmiRFP670
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mKate2
Plasmid#220599PurposeConstitutive expression of a single-cell discriminating version of mKate2 fluorescent protein.DepositorInsertmKate2
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-ArgiNLS-EGFP
Plasmid#220601PurposeCre-dependent expression of a single-cell discriminating version of EGFP fluorescent proteinDepositorInsertEGFP
UseAAV and Cre/LoxTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR104
Plasmid#185034Purpose400 nt l31 promoter region, l31 5'UTR A74 and A76 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationA74 and A76 deletion of rpmE 5'UTR, Only fir…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR105
Plasmid#185035Purpose400 nt l31 promoter region, l31 5'UTR G52 and G79 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG52 and G79 deletion of rpmE 5'UTR, Only fir…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR107
Plasmid#185037Purpose400 nt l31 promoter region, l31 5'UTR AGA74-76GAG mutation, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationAGA74-76GAG mutation of rpmE 5'UTR, Only fir…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR109
Plasmid#185038Purpose400 nt l31 promoter region, l31 5'UTR G60 and C69 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG60 and C69 deletion of rpmE 5'UTR, Only fir…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR110
Plasmid#185039Purpose400 nt l31 promoter region, l31 5'UTR G62 and G67 deletion, 90 nt of l31 coding region, glycine linker, sfGFP, trrnBDepositorInsertL31-sfGFP
ExpressionBacterialMutationG62 and G67 deletion of rpmE 5'UTR, Only fir…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL43C
Plasmid#218278PurposeIntroduction of a LowTempGAL Turbo module (GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only