We narrowed to 11,205 results for: cat.1
-
Plasmid#15162DepositorInsertPLAP (ALPP Human)
UseRetroviral; Avian expressionAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMC-XI1
Plasmid#176155Purposepreassembled yeast MoClo level-2 backbone with GFP dropout for genomic integration in site XI-1DepositorTypeEmpty backboneExpressionYeastAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Venus-Gprotein Gamma 9
Plasmid#42201DepositorInsertG protein Gamma 9
TagsVenus(1-155)ExpressionMammalianPromoterCMVAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMVTCRb_candidate1
Plasmid#164996PurposeExpression of candidate TCR #1 TCRbeta cDNADepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMVTCRa_candidate1
Plasmid#164995PurposeExpression of candidate TCR #1 TCRalpha cDNADepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS303:VC
Plasmid#37556DepositorInsertVenus C-term (aa 155-238)
ExpressionBacterialAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGWB602-MpPHOT-3xFLAG
Plasmid#228474PurposeMpPHOT-3xFLAG under the control of the cauliflower mosaic virus (CaMV) 35S promoter (for Agrobacterium-mediated genetic transformation.)DepositorInsertMpPHOT-3xFLAG
ExpressionBacterial and PlantAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB302-er-mCherry
Plasmid#186287PurposeBinary vector for the expression of er-mCherry (SP-mCherry-HDEL) in plants (for Agrobacterium-mediated genetic transformation and visualization of endoplasmic reticulum)DepositorInserter-mCherry
ExpressionBacterialAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
1026M=U6-3-gRNA#2[Pol-γ35]
Plasmid#159675PurposePlasmid supports expression of gRNA targeting Pol-γ35 site #2, tagged with mini-White, and can be integrated with phC31.DepositorInsertU6-3-gRNA#2[Pol-γ35]
UseCRISPRExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A500(KaganF60)
Plasmid#52003PurposeExpresses the human MAVS CDS containing a point mutation M1A and a C-terminal deletion removing the transmembrane domainDepositorInsertMAVS-M1A-500
ExpressionMammalianMutationchanged Met 1 to Ala and deleted the C-terminal t…Available SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-MAVS-M1A,M142A(KaganE20)
Plasmid#52011PurposeExpresses the human MAVS CDS containing the point mutations M1A and M142ADepositorInsertMAVS-M1A,M142A
UseRetroviralExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(W262S)
Plasmid#130670PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, W262SAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-humanized
Plasmid#44246PurposeExpression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdownDepositorInsertdead Cas9 with 3X NLS
UseCRISPR and Retroviral; VectorTags3x NLSExpressionMammalianMutationD10A H840A (catalytically inactive)PromoterMSCV LTR promoterAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 K720A
Plasmid#19939DepositorInsertcullin 1 K720A (CUL1 Human)
TagsHA2ExpressionMammalianMutationCUL1 with a NEDD8 modification mutantAvailable SinceApril 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF3109
Plasmid#144585PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28b-zDjCas13d-His
Plasmid#234481PurposePlasmid for bacterial expression and purification of DjCas13d protein (zebrafish codon-optimized)DepositorInsertDjCas13d
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0323
Plasmid#143394PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only