We narrowed to 9,835 results for: CAG
-
Plasmid#180252PurposeP. berghei D3 (502-617) construct with N516T, S533N and N539Q mutations to abolish N-glycosylation was used for crystallization.DepositorInsertD3 of P. berghei HAP2 with N-glycosylation sites mutated
Tags6HisExpressionMammalianMutationN516T, S533N and N539QAvailable sinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEh_gRNA1
Plasmid#178758PurposeExpression of a gRNA that targets next to PAM library, used for E. haloalkaliphila type I-E systemDepositorInsertgRNA that targets next to PAM library, used for E. haloalkaliphila type I-E system
ExpressionBacterialAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMs_gRNA1
Plasmid#178764PurposeExpression of a gRNA that targets next to PAM library, used for Marinomonas sp. type I-E systemDepositorInsertgRNA that targets next to PAM library, used for Marinomonas sp. type I-E system
ExpressionBacterialAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLm_gRNA1
Plasmid#178752PurposeExpression of a gRNA that targets next to PAM library, used for L. mobilis type I-E systemDepositorInserta gRNA that targets next to PAM library, used for L. mobilis type I-E system
ExpressionBacterialAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc2_gRNA1
Plasmid#178740PurposeExpression of a gRNA that targets next to PAM library, used for A. chroococcum type I-E #2 systemDepositorInsertgRNA that targets next to PAM library, used for A. chroococcum type I-E #2 system
ExpressionBacterialAvailable sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Olfr2
Plasmid#175935Purposeknockout mouse Olfr2DepositorInsertOlfr2 gRNA (Or6a2 Mouse)
UseRetroviralAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_CPR1_2
Plasmid#166071PurposePlasmid for constituive spCas9 expression and tet-inducible expression of an sgRNA targeting an intergenic site near CPR1 for double stranded break formation in yeast.DepositorInsertIntergenic region near CPR1
UseCRISPRExpressionYeastPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2H_Psyn-sgRNAmreB
Plasmid#149567PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable sinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-Cdt1
Plasmid#122342PurposeExpresses sgRNA targeting mouse Cdt1 and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Cdt1
ExpressionMammalianAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable sinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
gh20
Plasmid#106704Purposeexpression of gRNA targeting GALNT20DepositorInsertGALNT20
ExpressionMammalianAvailable sinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSM004
Plasmid#122937PurposeExpression of the marked mRNA under the control of substitutional promoters.DepositorInsertYML065W (Marked)
ExpressionYeastMutationYML065W: bp 52-63 GAGCAGGGAAAT to GAACAAGGTAACPromoter[tetO2]4inPgal1Available sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-fsaA
Plasmid#102286PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting fsaA.DepositorInsertfsaA gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable sinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-adhE
Plasmid#102290PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting adhE.DepositorInsertadhE gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable sinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN159
Plasmid#91688PurposeExpress sgRNA targeting human ZSWIM6DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN265
Plasmid#91616PurposeExpress sgRNA targeting human FUT9DepositorAvailable sinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
B33
Plasmid#74008PurposegRNA for B108DepositorInsertgRNA
UseCRISPRTagsnonePromoterU6Available sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only