We narrowed to 15,275 results for: grn
-
Plasmid#32806DepositorAvailable sinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
LCV2 STING KO
Plasmid#217445PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human STINGDepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDG459 V3
Plasmid#226958PurposeCBh-SpCas9-2A-Puro, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYC1446
Plasmid#158720PurposeIntegrating plasmid expressing Sth1 Cas9 and the cognate sgRNADepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-shLuc
Plasmid#73666PurposepSRIEN-RetroQ vector containing control sequence luciferaseDepositorInsertshRNA to Luciferase
UseRetroviralAvailable sinceApril 12, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
PX458_KMT2B_2
Plasmid#101075PurposeEncodes gRNA for 3' target of human KMT2BDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KMT2B_1
Plasmid#101074PurposeEncodes gRNA for 3' target of human KMT2BDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against KMT2B (KMT2B Human)
UseCRISPRAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shRFP
Plasmid#110940PurposeTet-inducible shRNA targeting RFPDepositorInsertshRFP
UseLentiviral and RNAiPromoterH1/TOAvailable sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pChimera
Plasmid#61476PurposeVector for conventional cloning that contains AtU6-26 promoter and sgRNA backboneDepositorInsertU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3s-Cas9-HN
Plasmid#104171PurposeCas9-WT mammalian expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-WT
UseCRISPRTagsHAExpressionMammalianMutationWTPromoterCMVAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_ATF4_2
Plasmid#72352PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATF4 (ATF4 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H2_1
Plasmid#36344DepositorAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pQCascade-IS1
Plasmid#140624PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS1. The crRNA-IS1 targets IS1 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS1
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
L4440-daf-16b
Plasmid#31504DepositorInsertdaf-16b specific (daf-16 Nematode)
UseRNAiAvailable sinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
L4440-daf-16af
Plasmid#31506DepositorInsertdaf-16a/f common (daf-16 Nematode)
UseRNAiAvailable sinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pBG-ttLbUV2
Plasmid#231386PurposeLbCas12a variant with D156R and E795L mutations and harboring same NLS sequence as PEmax but codon-optimized for dicot species; for Agrobacterium-mediated Arabidopsis transformation.DepositorInsertttLbCas12a Ultra V2
UseCRISPRExpressionPlantMutationD156R and E795LAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pQCascade-array1
Plasmid#140623PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-array1. The crRNA-array1 targets 8 different loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-array1
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MSCV-miRE_shBRD9_561-SV40-GFP
Plasmid#75139PurposeRetroviral expression plasmid encoding shBRD9_561 (targeting human BRD)DepositorInsertshBRD9_561
UseRetroviralAvailable sinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only