We narrowed to 9,761 results for: CAG
-
Plasmid#52920Purposeexpresses a hairpin specific for human p38MAPKDepositorInsertshRNA targeting mitogen-activated protein kinase p38 (MAPK14 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
BLBP-GFP
Plasmid#63174PurposeExpressing GFP from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-KATNA1
Plasmid#180650PurposeLentiviral expression vector for KATNA1. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. Internal ID: WISP20-47.DepositorInsertKATNA1 (KATNA1 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationsiRNA resistant to: GGACAGCACUCCCUUGAAAAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
H3K9me3 biosensor
Plasmid#120802PurposeFRET biosensor. To monitor histone H3 lysine 9 tri-methylation in mammalian cells by FRETDepositorInsertTruncated YPet-HP1-EV linker-ECFP-mouse histone H3
ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YD EGFP
Plasmid#187264PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsEGFPMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_puro_shNRF2-1
Plasmid#230086PurposeshRNA silencing human NRF2 geneDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHPHS232
Plasmid#228356PurposeLanding pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locusDepositorInsertsmTagBFP2
Reverse tetracycline transactivator 3
neo
TagsBlasticidin S deaminase and iCasp9ExpressionMammalianPromoterTRE3GV and gene trapAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-tet-puro-sh-ex16
Plasmid#35167DepositorAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
RpH-ILV-3xALFA
Plasmid#225135PurposeRpH-ILV probe strongly colocalises with lysosomal markers.DepositorInsertTMEM192 (TMEM192 Human)
ExpressionMammalianAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgR26
Plasmid#127376PurposeUsed for contransfection with pR26- and pR26-CMVconst-derived constructs to mediate CRISPR/Cas9 genomic insertion into the murine ROSA26 safe harbor locus.DepositorInsertROSA26 (Gt(ROSA)26Sor Mouse)
UseCRISPR and Mouse TargetingAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
FSW CHIP-Myc
Plasmid#246724PurposeNeuron-specific expression of human CHIP wildtype, and a myc-tag on its C-terminusDepositorInsertCHIP (Carboxy terminus of Hsc70-interacting protein) (STUB1 Human)
UseLentiviralTagsMycExpressionMammalianPromoterSynapsinAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shPOLE1_1
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only