We narrowed to 9,835 results for: CAG
-
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
SARS-CoV-2 spike G1 mutant
Plasmid#231913PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098 by implementing Asn-to-Gln mutationDepositorAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYAMTr2GCsgSeLEU2
Plasmid#224870PurposeDisruption of S. eubayanus type LEU2 genesDepositorInsertpYAMTr2GC having the guide sequence SeLEU2 (DI49_0736 Budding Yeast)
UseCRISPRExpressionYeastAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
U6-sgRNA-hcr3
Plasmid#193660PurposeExpression of tandem pre-sgRNA array hcr3 for LbCas12aDepositorInsertU6-CFTR-sgRNA-KLF4-sgRNA-TET1-sgRNA-tRNA
ExpressionMammalianPromoterU6Available sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-sgCIDE-1_U6-sgRNA-EF1a-mCherry2
Plasmid#211649PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertsgCIDE-1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgHSPC300-1
Plasmid#210141Purposeknock out HSPC300 in mammalian cellsDepositorInsertProtein BRICK1 (BRK1 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC-cUnaG
Plasmid#207631PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to C-terminal UnaG fragment.DepositorInsertphotocaged SpyCatcher-cUnaG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available sinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC-LPETG
Plasmid#207629PurposeA plasmid encoding photocaged SpyCatcher (pSC) with a C-terminal Sortase recognition sequence.DepositorInsertphotocaged SpyCatcher-LPETG
Tags6xHisExpressionBacterialMutationAmber stop codon at SC's critical lysinePromoterT7Available sinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPGD guide 1
Plasmid#193602PurposePGD knockoutDepositorInsertsgPGD guide 1 (PGD Human)
UseLentiviralAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#2/Cre
Plasmid#193228PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#2/Cre
Plasmid#193201PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L1-#2
Plasmid#171504Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330A-Blimp1-L2-#2
Plasmid#171506Purposedeletion of a genomic locus in Blimp1(Prdm1) geneDepositorAvailable sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA3_dTet_mTurquoise2
Plasmid#189806PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA3 (Runx3 Mouse)
UseRetroviralAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA2_dTet_mTurquoise2
Plasmid#189805PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA2 (Runx3 Mouse)
UseRetroviralAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only