We narrowed to 24,454 results for: ina
-
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCXIN- myc ULK1 4SA
Plasmid#27628DepositorInsertmouse myc ULK1 4SA (Myc Mouse)
UseRetroviralTagsmycMutationS467A, S555A, T574A, S637A. Initial M from ULK1 r…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPL001
Plasmid#184750PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
tetO-NR2F1
Plasmid#170698Purposedoxycycline-inducible overexpression of NR2F1DepositorInsertnuclear receptor subfamily 2 group F member 1 (NR2F1 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationdeletion of 36G- please see depositor commentsPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1136200-bio
Plasmid#47730PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1136200 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1136200
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin replaced…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
RCAS(A) dRhoA V14 (CT#846)
Plasmid#13949DepositorAvailable SinceFeb. 16, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEH_AAV_TERT_prom_-146C>T_C7C_1.8kb
Plasmid#183081PurposerAAV transfer plasmid with ITRs flanking: (1) TERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms, and (2) PGK-Puro.DepositorInsertTERT -146C>T promoter and exon 1 C7C (C21>T21), 1.8kb homologous recombination donor template with ~900 bp homology arms (TERT Human)
UseAAV; Homologous recombination donor templateMutation-146C>T promoter, Exon 1 C7C (C21>T21) sile…PromoterNone for primary insert (Though partial TERT prom…Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEX-CMV-SP-YFP-STM2(15-746AA)-EF hand 3 mut (K83A,D84N,G86D)
Plasmid#20174DepositorInsertpEX-CMV-SP-YFP-STM2(15-746AA)-EF hand 3 mut (K83A,D84N,G86D) (STIM2 Human)
TagsYFPExpressionMammalianMutation3 mutations (K83A,D84N,G86D) in the EF hand of ST…Available SinceMarch 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTBL1269 pLenti-CHYRON17-pEF1a(short)-Luc2-P2A-tdTomato-T2A-TdT
Plasmid#163643PurposeMakes a lentivirus that expresses hgRNA with 17nt spacer and Luc2, tdTomato, and human TdT.DepositorInsertsUseLentiviralTagsLuc2-P2A-tdTomato-T2AMutationThe SpCas9 sgRNA constant region is mutated to ma…PromoterEFS and pU6Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC
Plasmid#112617Purposepromoterless expression plasmid driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagstdTomatoExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTol2_LSEC:Cas9green; erbb2_gRNA171
Plasmid#199338PurposepDEL135; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous erbb2 sgRNADepositorInsertsLSEC
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CDKL1
Plasmid#23389DepositorInsertCDKL1 (CDKL1 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CDKL2
Plasmid#23421DepositorInsertCDKL2 (CDKL2 Human)
UseGateway CloningAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDmREDusk
Plasmid#213701PurposeVector for red-light-repressed bacterial gene expressionDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQLinkHD_mVenus
Plasmid#118861Purposefluorescent protein expression with an N-terminal His-tagDepositorInsertmVenus
TagsHis-tagExpressionBacterialAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
HHV7 U69 KD
Plasmid#26694DepositorInsertU69 (U69 Human Herpes Virus 7)
TagsHAExpressionMammalianMutationKinase Deficient Mutant Lys 202 mutated to AsnAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only