We narrowed to 8,420 results for: chloramphenicol
-
Plasmid#53076Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pBullet-er-c
Plasmid#53068Purposedestination vector with WAK2 (29 aa)-ECFP- ER marker (HDEL) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAM4663
Plasmid#85126PurposeNSIII -Cm-PkaiB-luc+ (firefly) vector constructed by seamless cloning with Cm casette codon optimized for S7942. PkaiB-luc+ amplified from pAM2105.DepositorInsertPkaiB-luciferase
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cyt-c
Plasmid#53066Purposedestination vector with cytosol marker (ECFP) for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyTagsECFP and EYFPAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-n
Plasmid#53069Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-end-n
Plasmid#53073Purposedestination vector with ECFP- endosome marker (RabF2a) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-pm-n
Plasmid#53077Purposedestination vector with PIP2a-ECFP (plasma membrane marker) for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBullet-vac-n
Plasmid#53075Purposedestination vector with vacuole marker (gamma-TIP) - ECFP for tagged fluorescent protein (N-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DV-IRES-myr-EGFP (JDW 495)
Plasmid#242574PurposeGateway destination vector with a CAGGS promoter in the backbone as well as an IRES-myr-EGFP to label cell membranes.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-TetOn-DEST-EFS-mODC-rtTA-IRES-NEO (JDW 931)
Plasmid#242578PurposePiggyBac transposon flanked, Tet-on, gateway destination vector.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DV-IRES-myr-mKate (JDW 494)
Plasmid#242575PurposeGateway destination vector with a CAGGS promoter in the backbone as well as an IRES-myr-mKate to label cell membranes.DepositorInsertattR1-CmR-ccdB-attR2
ExpressionMammalianPromoterCAGGSAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA-2xIns-fli1ep-zCreI-BFP (JDW 1218)
Plasmid#229819PurposeA gateway compatible Tol2 destination vector containing the fli1a promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-hsp70-zCreI-BFP (JDW 1184)
Plasmid#229831PurposeA gateway compatible Tol2 destination vector containing the hsp70 promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔPrD(kf)-SNAP
Plasmid#166150PurposeExpression of N. furzeri DDX5ΔPrD(1-535) mutant in E. coliDepositorInsertDDX5ΔPrD(1-535)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔPrD(1-535)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-His10-Smt3-DDX5ΔIDR(kf)-SNAP
Plasmid#166151PurposeExpression of N. furzeri DDX5ΔIDR(1-483) mutant in E. coliDepositorInsertDDX5ΔIDR(1-483)
TagsHis10-Smt3 and SNAPExpressionBacterialMutationΔIDR(1-483)PromoterT7Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pGPD-crtI-tNOS-pXYL-crtYB-tNOS+ku70 insD (SBE145)
Plasmid#195047Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pXYL-crtE-tNOS-pGPD-crtI-tNOS-pADH2-crtYB-tNOS+ku70 insD (SBE144)
Plasmid#195046Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only