We narrowed to 10,981 results for: cat.1
-
Plasmid#48745PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +2064 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +2064)
UseLuciferaseMutationtruncated promoter region (see pGL6)Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-humanized
Plasmid#44246PurposeExpression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdownDepositorInsertdead Cas9 with 3X NLS
UseCRISPR and Retroviral; VectorTags3x NLSExpressionMammalianMutationD10A H840A (catalytically inactive)PromoterMSCV LTR promoterAvailable SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-CUL1 K720A
Plasmid#19939DepositorInsertcullin 1 K720A (CUL1 Human)
TagsHA2ExpressionMammalianMutationCUL1 with a NEDD8 modification mutantAvailable SinceApril 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(W262S)
Plasmid#130670PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, W262SAvailabilityAcademic Institutions and Nonprofits only -
-
pX330-LMNA-gRNA1
Plasmid#122507Purposeexpresses WT spCas9 and a chimeric gRNA targeting human LMNADepositorInsertLMNA-gRNA1
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-DN-hCUL1-FLAG
Plasmid#15818DepositorAvailable SinceSept. 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin GFP
Plasmid#72919Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFPDepositorInsertchicken green opsin promoter
Available SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pcDNA3-DN-hCUL5-FLAG
Plasmid#15823DepositorAvailable SinceSept. 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
pTalpha1-iCre
Plasmid#133924PurposeNeuron-specific expression of iCreDepositorInsertiCre
ExpressionMammalianMutationCodon optimizedPromoterneuron-specific tubulin-alpha-1 promoterAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
OPN(-1206)-luc
Plasmid#31106DepositorInsertosteopontin promoter (SPP1 Human)
UseLuciferaseExpressionMammalianMutationpromoter region -1206 to +87Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
-
RCP83
Plasmid#163466PurposeBackbone plasmid for insertion of the Saccharomyces cerevisiae promoter library and yeGFPDepositorInsertsPromoter fragment (Sharon2012_1922)
His3 minimal promoter
yeGFP
ExpressionBacterial and YeastAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-Cdc45
Plasmid#126878PurposeExpresses human Cdc45 in bacteriaDepositorAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only