We narrowed to 2,657 results for: cmv promoter
-
Plasmid#62186PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertRenilla luciferase
UseLuciferase; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3.1-NLS(sv40) (RTW2624)
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) R4-R3
Plasmid#62169PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseLuciferase; Mule gateway entry vectorTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-FLAG-CFP-AMOT
Plasmid#235682PurposeExpress CFP tagged AMOT gene in mammalian cells using the CMV promoterDepositorInsertAMOT (AMOT Human)
UseLentiviralTagsFLAG-CFPExpressionMammalianMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.BC(p1-10)-CMVe-SCP1-TagBFP2-W3SL-BC(p1-10)
Plasmid#231354PurposeSingle stranded AAV genome with concatemerization-dependent barcodes, for tracking AAV concatemers via SpECTr. Also expresses TagBFP from SCP1 promoter and CMV enhancer.DepositorInsertBC(p1-10)
UseAAVTagsExpressionMutationPromoterAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eA3A-BE5-(NG)-PX458-EGFP
Plasmid#229687PurposeCRISPR CBE plasmid (C to T edits): eA3A-BE5-NG engineered to include the sgRNA cloning backbone from PX458 and EGFP. Includes BbsI sites for sgRNA cloning downstream of U6 promoter.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hOrf2mor-NLS(sv40) (BPK5095)
Plasmid#115141PurposeCMV-T7 promoter expression plasmid for human codon optimized Orf2mor anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized Orf2mor anti-CRISPR protein
UseTagsNLS(SV40)ExpressionMammalianMutationPromoterAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
EW489 CMV-TO-ZNF35(5-8)-ZNF250(1-4)-(GGS)x8[G2V G4W S6L G7L G10W G11D G13L G17M G19I G22M G23Q S24Q]-FKBP (FLP-IN)
Plasmid#236147PurposePlasmid encoding the ZNF35/ZNF250 zinc finger array attached by a deimmunized linker to FKBP1A, under control of CMV promoter with two TetR binding sitesDepositorInsertZNF35(5-8)-ZNF250(1-4)-deImmunLink-FKBP
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable sinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpCas9D10A nickase
Plasmid#216737PurposeExpresses SpCas9-D10A nickase from a CMVd1 promoter. For AAV packaging. Derived from pAAV-CMV-SpCas9 (Addgene #113034)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRTagsExpressionMammalianMutationD10APromoterCMVd1Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC592 - pCMV Mito-iRFP
Plasmid#59135PurposeA plasmid that express mitochondrial-targeted iRFP under the CMV promoter.DepositorInsertMitochondria-localized Infrared Fluorescent Protein
UseTagsMitochondria-targeting sequenceExpressionMammalianMutationPromoterCMV-IEAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC591 - pCMV Mem-iRFP
Plasmid#59134PurposeA plasmid that express membrane-targeted iRFP under the CMV promoter.DepositorInsertMembrane-localized Infrared Fluorescent Protein
UseTagsPalmitylation signalExpressionMammalianMutationPromoterCMV-IEAvailable sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV SpCas9
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionTagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-NF2-CFP
Plasmid#235687PurposeExpress CFP tagged NF2 gene in mammalian cells using the CMV promoterDepositorInsertNF2 (CA12 Human)
UseLentiviralTagsCFPExpressionMammalianMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-V5-RFP-MST2
Plasmid#235688PurposeExpress RFP tagged MST2 gene in mammalian cells using the CMV promoterDepositorInsertMST2 (STK3 Human)
UseLentiviralTagsV5-RFPExpressionMammalianMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP2u2-CMV-Ace2-IgG1
Plasmid#226455PurposeMammalian expression of human Ace2 protein under CMV promoter fused with IgG1, tagged with 6His, and released extracellular environment after expression for protein purificationDepositorInsertsAngiotensin Converting Enzyme 2
Immunoglobulin Heavy Constant Gamma 1
UseTags6xHis TagExpressionMammalianMutationPromoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only