We narrowed to 10,723 results for: SEC
-
Plasmid#38338DepositorAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only
-
-
pUASp YFP Rab32 CA
Plasmid#37740DepositorInsertRab32 (Rab32 Fly)
UseDrosophilaTagsYFPExpressionInsectMutationQ79L (constitutive active)PromoterGAL4Available SinceNov. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
BacPAK Flag-Adrm1
Plasmid#19419DepositorAvailable SinceNov. 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-His-Tipin-L195A
Plasmid#23121DepositorAvailable SinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNos-myrGFP
Plasmid#253595PurposeExpress myrGFP under Drosophila nanos promoterDepositorInsertmyrGFP
Tagsmyristoylation signalExpressionInsectPromoterNanos promoterAvailable SinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP35
Plasmid#247210PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2185 - pAAV nEF ConFoff hChR2(H134R)-mCherry
Plasmid#202546PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-Off)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2186 - pAAV nEF CoffFon hChR2(H134R)-mCherry
Plasmid#202547PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-Off and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R293A
Plasmid#246918PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R291AR293A
Plasmid#246919PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R291A, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW107
Plasmid#232796PurposeCOMPASS Fragment 2 (His-FLAG-ySet1, Cps30, Twinstrep-Cps40) in pBIG2abDepositorTagsHis6-3xFLAG, TwinstrepExpressionInsectMutationySet1(762-1080)Promoterpolyhedrin promoterAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only