We narrowed to 8,728 results for: lic
-
Plasmid#186895PurposeDoxycycline-dependent expression of mouse cGAS gene in mammalian cells by retroviral transductionDepositorInsertMouse cGAS truncation mutant (145-508 a.a.) with C-terminal HA tag (Cgas Mouse, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTetOne-orangutan cGASdeltaN-HA
Plasmid#186898PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal HA tag (CGAS Synthetic, Pongo abelii)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-rhesus macaque cGASdeltaN-HA
Plasmid#186866PurposeDoxycycline-dependent expression of rhesus macaque cGAS gene in mammalian cells by retroviral transductionDepositorInsertRhesus macaque cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (CGAS Synthetic, Macaca mulatta)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN-HA
Plasmid#186843PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-orangutan cGASdeltaN-GFP
Plasmid#186846PurposeDoxycycline-dependent expression of orangutan cGAS gene in mammalian cells by retroviral transductionDepositorInsertOrangutan cGAS truncation mutant (158-521 a.a.) with C-terminal GFP tag (CGAS Synthetic, Pongo abelii)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-chimpanzee cGASdeltaN-GFP
Plasmid#186847PurposeDoxycycline-dependent expression of chimpanzee cGAS gene in mammalian cells by retroviral transductionDepositorInsertChimpanzee cGAS truncation mutant (160-520 a.a.) with C-terminal GFP tag (CGAS Pan troglodytes, Synthetic)
UseRetroviralTagsGFPMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-HA-human cGASdeltaN
Plasmid#186852PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with N-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN
Plasmid#186854PurposeDoxycycline-dependent expression of human cGAS gene in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) without tags (Adamts1 Human, Synthetic)
UseRetroviralMutationN-terminal truncationPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A1.2-F192V-GFP (pc5115)
Plasmid#223438PurposeMutation phenylalanine 192 to valine (F192V) in macroH2A1.2-GFPDepositorInsertmacroH2A1.2-F192V (Macroh2a1 Rat)
TagsGFPExpressionMammalianMutationMutation of phenylalanine 192 to valine (F192V)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1297-AAV-EFSNC-dCjCas9-HP1b(79-173)
Plasmid#223142PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1298-AAV-EFSNC-dCjCas9-HP1bNH(111-173)
Plasmid#223143PurposeExpression of truncated HP1b with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1307-AAV-EFSNC-dSaCas9-HP1b(79-173)
Plasmid#223152PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 79-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmch-mTet1-ZF-CD pc3956
Plasmid#201709PurposeExpresses of mcherry-tagged mTet1-ZF-CD in mammalian cellsDepositorInsertTet1-ZF_CD (Tet1 Mouse)
TagsmCherryExpressionMammalianMutationZinc finger domain of Tet1 fused to its catalytic…PromoterCAGAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-ePhi29(+exo) (LM2995)
Plasmid#208966PurposeUnfused ePhi29 DNA polymerase (+exo), expressed from CMV or T7 promoters.DepositorInsertePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationePhi29(+exo)(M8R/V51A/M97T/G197D/E221K/Q497P/K512…PromoterCMV and T7Available SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only