We narrowed to 42,960 results for: gats
-
Plasmid#245486PurposepL1-R2-pAtUBI-RUBY-tRBCS (Golden Gate Level 1 module with a transcription unit expressing RUBY from the AtUBI promoter with the tRBC terminator for R2 position in Level 2 vector)DepositorInsertpAtUBI-RUBY-tRBCS
ExpressionPlantPromoterPolyubiquitin 10 gene from Arabidopsis thalianaAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pR2B6
Plasmid#245487PurposepL1-R2-pLsUBI-RUBY-tLsUBI (Golden Gate Level 1 module with a transcription unit expressing RUBY from the LsUBI promoter with the tLsUBI terminator for R2 position in Level 2 vector)DepositorInsertpLsUBI-RUBY-tLSUBI
ExpressionPlantPromoterPolyubiquitin 4 gene (LOC111919935) from lettuceAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP440
Plasmid#85937PurposeEncrypted AND gate, decryption step 1.DepositorInsertEncrypted AND gate, decryption step 1
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP447
Plasmid#85938PurposeEncrypted AND gate, decryption step 2.DepositorInsertEncrypted AND gate, decryption step 2
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOpen-ECOligA
Plasmid#165564PurposeConnects preferentially cohesive double-stranded DNA ends, active on blunt end DNA in the presence of Ficoll or polyethylene glycol. Requires Mg2+ and NAD+. Ligation when blunt end or RNA/ DNA ligation needs to be avoided.DepositorInsertE. coli DNA Ligase
UseSynthetic BiologyAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MS2592.EF1a.SLC6A1.S295L.RFP.P2A.PURO.JL.p163
Plasmid#170174PurposeLentiviral Expression of EF1a.SLC6A1.S295L.RFPDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.A288V.P2A.PURO.JL.p166
Plasmid#170171PurposeLentiviral Expression of EF1a.SLC6A1.A288VDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJQ200mp19
Plasmid#78501PurposeSuicide vector for allelic exchangeDepositorTypeEmpty backboneUseSuicide vector for gene replacementPromoternoneAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK611
Plasmid#72532PurposeProduces Acetobacter aceti 1023 formylglycinamidine ribonucleotide synthetase glutaminase subunit (AaPurQ); large subunit (AaPurL)DepositorInsertsformylglycinamidine ribonucleotide synthetase, glutaminase subunit
formylglycinamidine ribonucleotide synthetase, large subunit
ExpressionBacterialPromoterT7 and n/aAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSA40
Plasmid#35114DepositorInsertlys5 flanked by loxp
UseYeast replicatingAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
p5E-4xnrUAS (L4-R1)
Plasmid#61372Purpose5' Gateway Entry Clone Containing 4xnrUASDepositorInsert4xnrUAS
Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Brainbow3.0
Plasmid#45176DepositorInsertpCAG-Brainbow3.0
ExpressionMammalianAvailable SinceSept. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAM1414
Plasmid#40237DepositorInsertpromoterless luxAB reporter
UseCyanobacteria cloning vectorPromotern/aAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pET-GST
Plasmid#42049DepositorInsertGST
TagsHisExpressionBacterialAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
pAKgfp1
Plasmid#14076DepositorInsertGreen fluorescent protein
ExpressionBacterialAvailable SinceMarch 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHel3
Plasmid#102961PurposeE.coli/H.Pylori shuttle vectorDepositorTypeEmpty backboneUseShuttle vectorAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only