We narrowed to 24,346 results for: Sis
-
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast HA-GPAT4-ΔNs5
Plasmid#173169PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4 with mutation in CHP1 binding siteDepositorInsertGlycerol-3-Phosphate Acyltransferase 4 (GPAT4 Human)
UseRetroviralTagsHAMutationSynonymous mutations at sgRNA sites, amino acids …PromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast 3XFLAG-CHP1-myr_mut
Plasmid#173167PurposeRetroviral vector to express sgRNA resistant 3XFLAG tagged human CHP1 with myristoylation site mutationDepositorInsertCalcineurin Like EF-Hand Protein 1 (CHP1 Human)
UseRetroviralTags3XFLAGMutationSynonymous mutations at sgRNA sites, G2A, S6APromoterMMLVAvailable SinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-RPS14(WT)-Myc
Plasmid#122236Purposeexpresses RPS14 protein with a Myc tag in mammalian cells (hygro resistance)DepositorAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-tevopreQ1-epegRNA+13C>G_EF1a-puroR (PBS 14 - RTT 18)
Plasmid#207356PurposeLentiviral transfer plasmid encoding hU6-driven expression of a N1303K-CFTR correcting prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR + 13 C>G tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only