We narrowed to 16,460 results for: grn
-
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgUroD v4
Plasmid#158036Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse UroDDepositorInsertUroD sgRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre sgItgb5 v3
Plasmid#158038Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Itgb5DepositorInsertItgb5 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre sgRipk4 v3
Plasmid#158035Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Ripk4DepositorInsertRipk4 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
eSpCas9(1.1)-Cdt1
Plasmid#122342PurposeExpresses sgRNA targeting mouse Cdt1 and eSpCas9 in mammalian cellsDepositorInsertsgRNA for mouse Cdt1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9n-Nanog-L
Plasmid#122302PurposeExpresses sgRNA targeting mouse Nanog and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgIdua.CMV/CB-EGFP
Plasmid#121511PurposeExpresses sgRNA targeting mouse Idua intron 9 (sgIdua).DepositorInsertsgIdua
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgAspa.CMV/CB-EGFP
Plasmid#121510PurposeExpresses sgRNA targeting mouse Aspa intron 2 (sgAspa).DepositorInsertsgAspa
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN018
Plasmid#91664PurposeExpress sgRNA targeting human SCN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only