We narrowed to 11,803 results for: nsf
-
Plasmid#215277PurposeExpresses Vgat gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-EF1a-DIO-mCherry_Dicer gRNA
Plasmid#215279PurposeExpresses Dicer gRNA in a Cre dependent mcherry vectorDepositorInsertDicer control gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-hSyn-DIO-GCaMP8f_Grin1TTT gRNA
Plasmid#215282PurposeExpresses Grin1 Control gRNA in a Cre dependent GCaMP8f vectorDepositorInsertGrin1 control gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Seq17_VS33_4.26_ChimeraIntron_3NLS_RFP_WPRE_polyA
Plasmid#220225PurposeAAV-STARR-seq validation vector containing VS33 enhancerDepositorInsertEnhancer (VS33)
UseAAVExpressionMammalianPromoterCMVAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGex-6p2_NSD2
Plasmid#221376PurposeExpresses NSD2 in bacterial cellsDepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-flex-iGABASnFR2n-WPRE
Plasmid#218881PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAV and Cre/LoxExpressionMammalianMutationS99A F104H R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE
Plasmid#218873PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAVExpressionMammalianMutationS99A F102G R168PPromoterGFAPAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV-CAG-Sun1-GFP-WPRE-BC7-pA
Plasmid#220759PurposeExpression of Sun1GFP for nuclei isolation and Projection-TAG BC for multiplex projection tracingDepositorInsertSun1-GFP-WPRE-BC7
UseAAVPromoterCAGAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2(no bind)-WPRE
Plasmid#218876PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAVExpressionMammalianMutationS99A F102G R168PPromoterSynapsinAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-APOBEC1-YTHmut-EGFP
Plasmid#209323PurposeAAV packaging vector containing a APOBEC1-YTHmut expression cassette, a P2A-EGFP expression cassette.DepositorInsertAPOBEC1--YTHmut-HA
UseAAVTagsHAMutationYTH domain lacks AA 385-409 comprising the m6A-bi…Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-EGFP-APOBEC1-YTHmut
Plasmid#209320PurposeAAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTHmut cassette.DepositorInsertAPOBEC1-YTHmut-HA
UseAAVTagsHAMutationYTH domain lacks AA 385-409 comprising the m6A-bi…Available SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_05-mEGFP_WRPE-SV40
Plasmid#194689PurposehSyn1 driven expression of the calcium recorder Caprola_05 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_05-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-myr-rsEGFP2- LDLR
Plasmid#213399Purposedouble floxed, myristoylation site (myr) and LDLR, fused to reversibly switchable EGFP rsEGFP2DepositorInsertrsEGFP2
UseAAVTagsC-terminal (Ct) cytoplasmic domains of low densit…ExpressionMammalianAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS_LF
Plasmid#213394PurposeLoss of function variant of uMASS_1 opioid sensor. AAV virus production for Cre dependent expression.DepositorInsertuMASS_LF
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-TadA7.10-SpG N aa2-713-InteinN
Plasmid#206967PurposeExpresses TadA7.10 and SpG cas9N by the constitutive CMV promoterDepositorInsertCMV, TadA7.10, SpG N
UseAAVPromoterCMVAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only