We narrowed to 41,926 results for: TRO
-
Plasmid#221330PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Rac1 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRetroX-TetOne-Puro-p62 K7A/D69A
Plasmid#204549PurposeExpresses p62 K7A/D69A in a doxycycline-dependent manner in mammalian cellsDepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
SVA-lncRNA AK057321 shRNA 1A scramble control
Plasmid#202835PurposeLentiviral vector that expresses a scrambled control shRNA for SVA-lncRNA AK057321 shRNA 1ADepositorInsertpLVX-SVA-lncRNA shRNA 1A scramble control
UseLentiviralExpressionMammalianPromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 RFP i670
Plasmid#155345PurposeLentiviral expression of humnan CIT shRNA, RFP i670 expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a-GFP-Patronin CC 534–868
Plasmid#59054Purposefor E. coli expression of Patronin CC truncationDepositorAvailable SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A,M142A-invitro(KaganE14)
Plasmid#52018PurposeUsed for in vitro expression of the human MAVS CDS containing the point mutations M1A,M142ADepositorInsertMAVS-M1A,M142A
ExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233034PurposeTo Express HA tagged hfCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInserthfCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MelanoTag-Control-PURO (pLJC5-GPR143-mScarlet-1xMyc)
Plasmid#160368PurposeStable expression of GPR143-mScarlet-1xMyc fusion protein for use as a control with MelanoTag-PURODepositorAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3XFLAG-renilla-luciferase-beta-globin-control
Plasmid#184393PurposeTransient transfection plasmid expressing Renilla-luciferase-beta-globin fusion proteinDepositorInsertRenilla luciferase
Tags3X FLAGExpressionMammalianPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV intron renilla TRICK CTE polyA
Plasmid#84443PurposeTRICK reporter mRNADepositorInsertRenill-TRICK
UseLuciferase; FrtExpressionMammalianPromoterTet-CMVAvailable SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-PTuner DD-M.EcoGII-v5-Telomeric repeat-binding-factor1
Plasmid#122084PurposeExpress M.EcoGII fused to TRF1 with detabilization domain - inducibleDepositorInsertDD-linker-M.EcoGII-V5-TERF1
UseRetroviralTagsV5 tag on Nter of TERF1ExpressionBacterial and MammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorInsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV Synapsin Intron H2B Gcamp 6s wpre Pzac2.1
Plasmid#74150Purposecalcium sensorDepositorInsertGCaMP6s
UseAAVTagsH2BPromoterSynapsinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV Synapsin Intron H2B Gcamp 6f wpre Pzac2.1
Plasmid#74144PurposeCalcium sensorDepositorInsertGCaMP6f
UseAAVTagsH2BPromotersynapsinAvailable SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 MCS-ZKSCAN1 548-1417 (No intron)
Plasmid#69898PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceNov. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform B (codon optimized)
Plasmid#199567PurposeStable and dox. inducible expression of Trim69 isoform B (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform B (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only