We narrowed to 9,980 results for: Uty
-
Plasmid#194694PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertCaprola_on-mEGFP
UseLentiviralTagsmEGFPPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A24
Plasmid#135507PurposeMammalian expression of myc-tagged HLA-A*024:02DepositorInsertHLA-A*24:02 (HLA-A Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHB2 S39D-mCherry
Plasmid#232787PurposeEncodes an mCherry-tagged Prohibitin2/PHB2 constitutively phosphorylated on Ser39DepositorInsertPHB2 (PHB2 Human)
TagsmCherryExpressionMammalianMutationChanged Serine 39 to AspartatePromoterCMVAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX317-SNAI1
Plasmid#115446PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (5B)
Plasmid#85498PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32H H70C D158S I159A L162RPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT899
Plasmid#228288PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TACR1-DuET
Plasmid#213385PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA1-28-pA
Plasmid#55200PurposePlasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pGFAP-AcGFP
Plasmid#133733PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a GFAP promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpGFAP and pTRE3G-BiAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
MRGPRX1-DuET
Plasmid#213344PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX317-RBFOX1
Plasmid#115442PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT_CMV_NES-Caprola_on-mEGFP
Plasmid#194686PurposeCMV driven expression of the consitutively active calcium recorder positive control Caprola_on in mammalian cell lines fused to mEGFPDepositorInsertCaprola_on-mEGFP
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
Stat3 S727A pRc/CMV
Plasmid#8708DepositorInsertStat3 S727A (Stat3 Mouse)
ExpressionMammalianMutationS727A (exhibits o serine phosphorylation either c…Available SinceAug. 11, 2005AvailabilityAcademic Institutions and Nonprofits only -
pFRT-DestFLAGHA_RBPMS
Plasmid#65743Purposeconstitutively expresses RBPMS in mammalian cellsDepositorAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ5429_pUC_hU6-crScaffold_EF1a-BFP
Plasmid#155306PurposeRfx Cas13d guide cloning pUC19 vector with constitutively expressed tagBFPDepositorInsertRfx Cas13d CRISPR RNA BFP
ExpressionMammalianPromoterhU6, EF1aAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
LUC01 (L/Sec/P)
Plasmid#112144PurposeMammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activityDepositorInsertLuciferase coding region with Cysteine 258 mutated to selenocysteine (U) and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Photinus pyralis, Rat)
ExpressionMammalianMutationCysteine 258 mutated to selenocysteine (U)Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
J23104-mRFP1-331Bb
Plasmid#78274PurposemRFP1 behind constitutive promoter J23104 in pSEVA331Bb backboneDepositorInsertJ23104-mRFP1
Available SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
SiriusGFP
Plasmid#123201PurposeWe have developed a variant of eGFP, SiriusGFP, that shows over a two fold increase in photostability with utility in methods requiring sustained or high intensity excitation as in 4D confocal or SIM.DepositorInsertSiriusGFP
UseMouse TargetingTagsN/AExpressionBacterial and MammalianMutationeGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-IFNA-neo
Plasmid#225710PurposeThe pCDH-IFNA-neo plasmid is designed for the overexpression of human IFNα in mammalian cells. This plasmid was utilized to engineer A549 cells for stable IFNα overexpression.DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only