We narrowed to 24,905 results for: promoter
-
Plasmid#16795DepositorUseXenopus expressionMutationChimera of beta 2 adrenergic receptor (extracellu…Available SinceMarch 13, 2008AvailabilityAcademic Institutions and Nonprofits only
-
pEHC
Plasmid#112615Purposepromoterless expression plasmid driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsEmeraldExpressionMammalianPromoterNo PromoterAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC
Plasmid#112616Purposepromoterless expression plasmid driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsmTeal (mTFP1)ExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
mHDAC7-Unspliced (23-938) pEF6-Flag (MJS_018)
Plasmid#73269PurposemHDAC7-U (23-938) pEF6-V5 (MJS_017) (Flag tag)DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-gap_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107577PurposeB. megaterium DSM319 gap promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromotergapdh promoter - B. megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-SLC31A1
Plasmid#251694PurposeGateway-adapted SLC31A1 ORFDepositorInsertSLC31A1 solute carrier family 31 member 1 (SLC31A1 Human)
UseGateway donor vectorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-myc-S1-CC1-NP2
Plasmid#248976PurposeRetroviral expression vector for myc-tagged mouse SUN1-SUN2 chimera protein (Nucleoplasmic region of SUN2 and coiled coil region and SUN domain of SUN1)DepositorInsertUseRetroviralTagsMycAvailable SinceFeb. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-myc-S1-CC2-NP2
Plasmid#248977PurposeRetroviral expression vector for myc-tagged mouse SUN1-SUN2 chimera protein (Nucleoplasmic and coiled coil regions of SUN2 and SUN domain of SUN1)DepositorUseRetroviralTagsMycAvailable SinceFeb. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-myc-S2-CC2-NP1
Plasmid#248978PurposeRetroviral expression vector for myc-tagged mouse SUN1-SUN2 chimera protein (Nucleoplasmic region of SUN1 and coiled coil region and SUN domain of SUN2)DepositorInsertUseRetroviralTagsMycAvailable SinceFeb. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-myc-S2-CC1-NP1
Plasmid#248979PurposeRetroviral expression vector for myc-tagged mouse SUN1-SUN2 chimera protein (Nucleoplasmic and coiled coil regions of SUN1 and SUN domain of SUN2)DepositorUseRetroviralTagsMycAvailable SinceFeb. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC18T-mini-Tn7T-Gm-CC
Plasmid#246943PurposePlasmid strain containing pUC18T-mini-Tn7T-Gm-CC01 plasmid, which will insert a nonsense spacer version of the synthetic CRISPR-Cas system from P. aeruginosa PA14 into the genome at the att-Tn7 site.DepositorInsertType IF CRISPR-Cas system from Pseudomonas aeruginosa PA14
UseSynthetic BiologyExpressionBacterialPromoterNative promoters from PA14Available SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJTB126
Plasmid#248910Purposeexpresses the yeast analog-sensitive Smk1-Q120A and Ssp2 fused to glutathione-S-transferase in bacteriaDepositorInsertsSMK1 Mitogen-activated Protein Kinase -analog-sensitive form (SMK1 Sequence is from the SK1 isolate of S. cerevisiae and will differ by 1 non-synonomous/several synonymous changes from S288C form, Budding Yeast)
Ssp2 Activator of the Smk1 MAPK (SSP2 Sequence is from the SK1 isolate of S. cerevisiae and may differ by synonymous changes from S288C form, Budding Yeast)
Tagsglutathione-S-transferaseExpressionBacterialMutationcodon 120 has been changed from Q to A (Smk1-Q120…PromoterT7Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
L4385 dsRedExpress2 reporter, IL-10Rb NTEVp, IL-10Ra CTEVp in PiggyBac Transposon Vector
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Human, Synthetic)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 long
Plasmid#74469PurposeExpresses Cd99l2 transcript variant 1-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 1 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cd99l2 short
Plasmid#74470PurposeExpresses Cd99l2 transcript variant 2-IRES-EGFP under CAG promoter in mammalian cellsDepositorInsertCD99 antigen-like 2, transcript variant 2 (Cd99l2 Mouse)
ExpressionMammalianPromoterchicken beta actin promoterAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Tre-Rac1-P29S (FLARE)
Plasmid#241371PurposeDox-inducible expression of Rac1-P29S FLARE sensorDepositorUseLentiviralTagsYPet (N terminal to Pak1) and mCerulean3 (N termi…MutationP29S in Rac1PromoterTREAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NONO2_IDR-EGFP
Plasmid#232765PurposeExpresses dCas9-NONO2_IDR-EGFPDepositorAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only