We narrowed to 14,209 results for: CAR
-
Plasmid#178234PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.S.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Control-cx43.4-48H-pPRISM
Plasmid#117801PurposeControl to test technique on a target that is known to workDepositorInsertTagRFP
UseSynthetic BiologyAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-CsChR-GFP
Plasmid#58841PurposeAAV expression of CsChR-GFP under the Syn promoterDepositorInsertCsChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSAM2_mCherry_Nkx2.5
Plasmid#72689PurposeDoxycyline regulated expression of Nkx2.5 in mammalian cellsDepositorAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBRPyCAG-fmKlf4-DsRed-Ip
Plasmid#26274DepositorAvailable SinceSept. 16, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2b-K660N
Plasmid#45707DepositorAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBW2286_pCAG-PV1-FlpO-N396-L1-ABI-NLS-BGHpA
Plasmid#108769PurposeExpresses N-terminus to aa396 of Flp recombinase fused to ABI CIDDepositorInsertFlp recombinase fragment N-terminus to aa396
UseCre/Lox and Synthetic BiologyTagsABI,NLSExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.V5_mCherry-NLS
Plasmid#178242PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.V5 and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:MS2:EDLL:Tnos (GB1738)
Plasmid#160622PurposeTU for the constitutive expression of the MS2 coat protein fused on Ct to the activation domain EDLLDepositorInsertP35s_MS2:EDLL_Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMED3-hLOV-TEVcs-GAL4bd-VP64-V5
Plasmid#170996PurposeHiLITR transcription factor with full-length TMED3 targeting sequence (ER/Golgi)DepositorInsertTMED3(FL)-NNES-hLOV-TEVcs(ENLYFQ/M)-GAL4bd-VP64-V5 (TMED3 Synthetic)
UseLentiviral and Synthetic BiologyTagsV5ExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-Klf4
Plasmid#136613PurposeDox-inducible lentiviral vector expressing mouse Klf4DepositorAvailable SinceMarch 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2112
Plasmid#49137PurposeAAV plasmid with NR2E1 (Ple264) promoter driving expression of EmGFP.DepositorInsertssAAV-Ple264-emGFP
UseAAVExpressionMammalianPromoterNR2E1Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
1D3 HC
Plasmid#170670PurposeMammalian Expression Plasmid of Anti-cytochrome c, 1D3 HC (Human)DepositorInsertHC of anti-cytochrome c, 1D3 (human) recombinant mouse monoclonal antibody
ExpressionMammalianAvailable SinceJuly 12, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
1D3 LC
Plasmid#170669PurposeMammalian Expression Plasmid of Anti-cytochrome c, 1D3 LC (Human)DepositorInsertLC of anti-cytochrome c, 1D3 (human) recombinant mouse monoclonal antibody
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
tRNA-gRNA position [D1_n-1] (GB1208)
Plasmid#75409PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [D1_n-1]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter (2-part multiplexing)DepositorInserttRNA-gRNA position [D1_n-1]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.VSVg_mCherry-NLS
Plasmid#178220PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.S_mCherry-NLS
Plasmid#178219PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only