We narrowed to 3,202 results for: Streptococcus
-
Plasmid#209450PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
EC70190
Plasmid#209451PurposeCloning protospacers for Cas9 editingDepositorInsertCas9 sgRNA
UseCRISPRPromoterHvU3Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
PET-Sniper SpCas9-NLS-6xHis
Plasmid#207374PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertSniper SpCas9
UseCRISPRTags6xHisExpressionBacterialMutationF539S, M763I, K890NPromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV489
Plasmid#177697PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ) and TDH3p (Candida…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAH235
Plasmid#121145PurposeCas9 expression controlled by the nmt41 promoterDepositorInserthumanized Streptococcus pyogenes Cas9
UseCRISPRTagsFlagExpressionYeastPromoternmt41Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_MTH17CL396
Plasmid#136656PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:MTH17CL396 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:MTH17CL396 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_TH1477
Plasmid#136655PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9:TH1477 Chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMG18311
Plasmid#136653PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD9:LMG18311 chimera
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRB1083
Plasmid#71480PurposeExpresses VRER Cas9 variant with eef-1A.1 (eft-3) promoterDepositorInsertVRER Cas9 variant
UseCRISPRExpressionWormPromotereft-3 (eef-1A.1)Available SinceDec. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSHS273 - Bacterial expression plasmid for SpCas9∆REC3 variant
Plasmid#101202PurposeBacterial expression plasmid for SpCas9∆REC3 variantDepositorInsertSpCas9 variant M1–N497,GGS,V713–D1368
Tags10x His, MBP, and TEV siteExpressionBacterialMutationM1–N497, GGS, V713–D1368PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC228 - Bacterial expression plasmid for SpCas9 Cluster 2 variant
Plasmid#101233PurposeBacterial expression plasmid for SpCas9 Cluster 2 variantDepositorInsertSpCas9 variant G582A/V583A/E584A/D585A/N588A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationG582A, V583A, E584A, D585A and N588APromoterT7Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEC3006 (pSpy1C-PZn_ffluc)
Plasmid#218515Purposereplicative E. coli-S. pyogenes shuttle plasmid for zinc-inducible expression of the Firefly luciferase in S. pyogenesDepositorInsertffluc
UseLuciferaseExpressionBacterialMutationdeletion of Plac_mrfp cassettePromoterPZn (PczcD)Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPMQAK1-Ptrc-[E*](104)-Cas9-B0015-lacZ-PnrsB-mazF-LVA
Plasmid#190790Purpose[E*](104) construct. Theophylline inducible Cas9 (S. pyogenes) expression. Two BsaI-sites allow for simultaneous insertion of sgRNA and donor DNA. Includes a nickel-inducible curing system.DepositorInsertsCas9
mazF-LVA
UseCRISPR and Synthetic BiologyTagsLVAExpressionBacterialMutationsilent mutations of BpiI-sites in original Cas9 g…PromoterPnrsB and Ptrc-[E*](104)Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK Cas9-2A-Citrine
Plasmid#92393PurposeEnhancer/reporter plasmid for tissue-specific expression of Cas9 with 2A-Citrine reporter. Contains BsmBI-flanked LacZ cloning cassette for rapid GoldenGate-based cloning of specific enhancers.DepositorInsertCas9 2A Citrine
UseCRISPRExpressionMammalianPromoterthymidine kinase promoterAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
SpCas9_sgRNA_expression_in_pBluescript
Plasmid#122089PurposeU6 driven SpCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEC2735 (pSpy0C2)
Plasmid#220279Purposeintegrative plasmid for heterologous gene expression in S. pyogenes SF370, integrates into the amyA locus via homologous recombinationDepositorTypeEmpty backboneExpressionBacterialAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
LacD.1_WT_pET21a
Plasmid#29789DepositorInsertTagatose 1,6-diphosphate aldolase (lacD.1 S. pyogenes (serotype M1))
TagsHisExpressionBacterialAvailable SinceMarch 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
LacD_WT_pET21a
Plasmid#29785DepositorInsertTagatose 1,6-diphosphate aldolase
TagsHisExpressionBacterialAvailable SinceJuly 7, 2011AvailabilityAcademic Institutions and Nonprofits only