We narrowed to 4,991 results for: IRES
-
Plasmid#215152PurposeExpresses FFSS-Cyclin D1 in mammalian cells from a lentiviral vector.DepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagsFFSS (FLAG-FLAG-STREP-STREP)ExpressionMammalianMutationWith T286A mutation.PromoterCMVAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIH-mRuby2-BAK
Plasmid#111627PurposeFluorescent fusion protein used to visualise mouse BAK, with hygromycin selectionDepositorAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GRB10_WT
Plasmid#82124PurposeGateway Donor vector containing GRB10 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iG-CSF2RB(A455D)
Plasmid#125751PurposeLentiviral Expression Vektor with CSF2RB-A455D mutant cDNA and IRES eGFPDepositorInsertCSF2RB(A455D)
UseLentiviralMutationA455D, codon optimizedPromoterSFFVAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI AscI MR1 R9H res
Plasmid#214753Purposeexpresses human MR1 R9H resistant to CRISPR editing with a specific sgRNA in mammalian cellsDepositorInsertMHC class I-related protein 1 (MR1 Human)
TagsIRES eGFPExpressionMammalianMutationsilent mutations to prevent editing by CRISPR/Cas…PromoterCMVAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hNFATc2/C(1-686, RIT)FLAG-AVITEV
Plasmid#74055Purposeretroviral expression plasmid for human NFATc2/C(1-686, RIT) (without C-terminal region, with RIT mutation abrogating AP1 binding) with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman NFATc2, isoform C (NFATC2 AS 1-686 (N terminus deleted), Human)
UseRetroviralTagsAVI-TEV and FLAGExpressionMammalianMutationsilent mutation A1723C in the sequence of NM_1730…Available SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
LeGO-iG-CSF2RB
Plasmid#125750PurposeLentiviral Expression Vektor with CSF2RB wildtype cDNA and IRES eGFPDepositorAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only