We narrowed to 9,263 results for: CAG
-
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 PSMB5 guide 2
Plasmid#117074Purposesingle guide RNA targeting PSMB5; guide 2DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001147564)
Plasmid#77644Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-4-EF1a-LibVec
Plasmid#239600Purposeexpresses guide#4 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASK [K56A/50R-2b]
Plasmid#222168PurposeMammalian Expression Plasmid of anti-CASK (Human). Derived from hybridoma K56A/50.DepositorInsertAnti-CASK (Homo sapiens) recombinant mouse monoclonal antibody. (CASK Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 TL
Plasmid#188150PurposeExpresses C-terminal flag-tagged human CAD hCPS1 TL in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7(res)
Plasmid#160106PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 UBE2C guide 1
Plasmid#117068Purposesingle guide RNA targeting UBE2C; guide 1DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only