We narrowed to 13,735 results for: 109
-
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SRR134.3_miRFP670
Plasmid#163754PurposegRNA expression vector containing the miRFP670 fluorescent marker to target the region downstream of the SRR134 SOX2 enhancer in human cells.DepositorInsertgRNA_SRR134.3
UseCRISPRTagsmiRFP670ExpressionMammalianPromoterU6Available SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBa.PEX 1-42-tdTM-FKBP
Plasmid#224415PurposeMammalian expression of Pex3DepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
300_pETcon_SARS2_FLip
Plasmid#222230Purposeyeast surface display of the SARS-CoV-2 FLip variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
297_pETcon_SARS2_Omicron-BA286
Plasmid#222231Purposeyeast surface display of the SARS-CoV-2 BA.2.86 variant RBDDepositorInsertSARS-CoV-2 BA.2.86 RBD (S Budding Yeast, SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
299_pETcon_SARS2_EG-5
Plasmid#222232Purposeyeast surface display of the SARS-CoV-2 EG.5 variant RBDDepositorAvailable SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTarget-Dual
Plasmid#207884PurposeCarries the cognate target sites for the homing endonucleases I-OnuI and I-GpeMI.DepositorInsertsI-OnuI target site
I-GpeMI target site
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK43
Plasmid#222223PurposeEdits NPAS2 Gene.DepositorAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRAR119
Plasmid#185051PurposeJ23108(spel), pHP14 stability hairpin, strong RBS, L34 coding region, trrnBDepositorInsertL34
ExpressionBacterialAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-N1_CBPdIDR7KTG
Plasmid#221915PurposeTransient expression of GFP-tagged CBPdeltaIDR7KTG in mammalian cellsDepositorInsertCBP (CREBBP Human)
TagsGFPExpressionMammalianMutationdeletion of IDR7 (aa 2109-2434); mutation of lysi…Available SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0.378
Plasmid#203937PurposeDown Flank. Neutral site. Down flanking sequence of ω3 acyl-lipid desaturase (desB, FEK30_04840) in Synechococcus sp. PCC 11901.DepositorInsertdesB DOWN
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC0.438
Plasmid#203943PurposeDown Flank. Neutral site. Up flanking sequence of intergenic region (NS1) between FEK30_11550 and FEK30_11555 in Synechococcus sp. PCC 11901.DepositorInsertNS1 DOWN
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRH3128
Plasmid#210165PurposeProtein quality control substrate and associated control YIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1DepositorInsertYIp ADE2-LEU2 pTDH3::ADE1-GFP::tADH1 (ADE2 Budding Yeast)
ExpressionYeastAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA-hIRF-1 #12/pSIR-hCD2
Plasmid#135392PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoterDepositorInsertgRNA_hIRF1 promoter #12
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pzk490-pmax-NES-dpspCas13b(AAAA)-FseI[ADAR2-DD-splitC]
Plasmid#196843PurposeExpress NES-dpspCas13b(AAAA)-FseI[ADAR2-DD-splitC]DepositorInsertNES-dpspCas13b(AAAA)-FseI[ADAR2-DD-splitC]
ExpressionMammalianAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only