We narrowed to 9,396 results for: CAG
-
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP1
Plasmid#184556PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2-RBD
Plasmid#184830PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA2-RBD (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.2 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.1-RBD
Plasmid#184831PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.1 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.1 (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.1 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJT230 lenti pEF-rTetR(SE-G72P)-3XFLAG-NCOA3-TAD-T2A-mCherry-BSD-WPRE
Plasmid#188763PurposeLentiviral backbone containing NCOA3 as a fusion with rTetR(SE-G72P)-3XFLAGDepositorInsertNCOA3 (NCOA3 Human)
UseLentiviralTagsrTetR(SE-G72P)-3xFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001147564)
Plasmid#77644Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-4-EF1a-LibVec
Plasmid#239600Purposeexpresses guide#4 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASK [K56A/50R-2b]
Plasmid#222168PurposeMammalian Expression Plasmid of anti-CASK (Human). Derived from hybridoma K56A/50.DepositorInsertAnti-CASK (Homo sapiens) recombinant mouse monoclonal antibody. (CASK Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Synthetic, Human)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only