We narrowed to 9,280 results for: Pol;
-
Plasmid#241977PurposeOver-express Sc Pri1 & Pri2 (Sc pol alpha subunits) in yeast (integrated)DepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Sc FLAG-rad30-pRS403/GAL
Plasmid#241260PurposeOver-express Sc FLAG-rad30 (Sc Pol eta) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc rev3-FLAG-pRS402/GAL
Plasmid#241258PurposeOver-express Sc rev3-FLAG (Sc Pol zeta subunit) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ec holD-pET(3c)
Plasmid#237236Purposeover-express E. coli holD (Pol III psi subunit)DepositorInsertholD (psi) (holD E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec dnaN-pET(11a)
Plasmid#237238Purposeover-express E. coli dnaN (Pol III beta sliding clamp subunit)DepositorInsertdnaN (beta) (dnaN E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holA-pET(11a)(ACH-)
Plasmid#237233Purposeover-express E. coli holA (Pol III delta subunit)DepositorInsertholA (delta) (holA E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holC-pET(3c)
Plasmid#237235Purposeover-express E. coli holC (Pol III chi subunit)DepositorInsertholC (chi) (holC E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec dnaX(T-only)-pET(3c)
Plasmid#237237Purposeover-express E. coli PolX (Pol III tau subunit - no gamma)DepositorInsertdnaX (tau only) (dnaX E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ec holB-pET(11a)(ACH-)
Plasmid#237234Purposeover-express E. coli holB (Pol III delta prime subunit)DepositorInsertholB (delta prime) (holB E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADF shRNA mouse
Plasmid#245952PurposeFor making other mouse ADF silencing vectorsDepositorAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCL-Eco
Plasmid#12371DepositorInsertgag/pol/env
UseRetroviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8001 - pCMV-R8.91 (D64V)
Plasmid#202687PurposeR8.91 plasmid with mutated integrase (D64V)DepositorInsertgag pol
UseLentiviralExpressionMammalianMutationD64VAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ec dnaN-pHK/P
Plasmid#237239Purposeover-express E. coli hk/P-dnaN (Pol III beta sliding clamp subunit, N-terminal cleveable his-kinase tag)DepositorInsertdnaN (beta), N-terminal his-kinase cleavable tag (dnaN E. coli)
Tagshis-10+PKA kinase motif+PreScission Protease clea…ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMLS134
Plasmid#73714PurposeSapTrap destination vector for building sgRNA expression vectors.DepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shKGA
Plasmid#110420PurposeshKGA, silence glutaminase KGA isoform, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS256
Plasmid#73715PurposeSapTrap destination vector for building combined sgRNA expression + repair template vectorsDepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
huCof WT + rat cof shRNA
Plasmid#245961PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of WT human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianPromoterNeuronal Specific Enolase (NSE) for cofilin and p…Available SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSE-huCof K22Q + rat cof shRNA
Plasmid#245962PurposeSilencing of endogenous cofilin in rat/mouse neurons with replacment by neuronal specific expression of K22Q mutant of human cofilinDepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutationK22QPromoterNSE for cofilin K22Q and pol III for shRNAAvailable SinceOct. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCof null + rat cof shRNA
Plasmid#245960PurposeSilencing of endogenous cofilin in rat/mouse cells with replacement by an inactive human cofilin expressed with a cofilin promoter (control for plasmid listed above)DepositorInsertcofilin 1 (cfl1) (CFL1 Human)
ExpressionMammalianMutation_1-5, Y82F, KK95,96QQPromoterMCP for cofilin and pol III for shRNAAvailable SinceOct. 21, 2025AvailabilityAcademic Institutions and Nonprofits only