We narrowed to 15,275 results for: grn
-
Plasmid#80145Purposeretroviral expression of random shRNADepositorInsertrandom shRNA
UseRetroviralExpressionMammalianAvailable sinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTER_MDC1 (422-2)
Plasmid#22191DepositorInsertsh Mediator of DNA damage checkpoint 1
UseRNAiExpressionMammalianAvailable sinceJan. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHS1182
Plasmid#205964PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1DepositorInsertDinG HNH crRNA
ExpressionBacterialPromoterT7Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-3'UTR
Plasmid#136049PurposeSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK0_003
Plasmid#123925PurposeEncodes the spCas9 cassette and spCas9 gRNA GFP dropout expression cassette final destination vector as a type 0 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-sgRNA destination
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-DoxOn-shCUX1-5150
Plasmid#90469PurposeLentiviral vector expressing a doxycycline-inducible shRNA against human CUX1 sequence starting at 5150 of M74099DepositorInsertTGCTGTTGACAGTGAGCGTCAGAGCGATAATACACTATTATAGTGAAGCC
UseLentiviral and RNAiExpressionMammalianAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-H11r1-2-DD-Cas9
Plasmid#85978PurposeExpresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cellsDepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianAvailable sinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-Sh-Ctrl
Plasmid#85587PurposeControl hairpin sequence used in gene knockdown experiementsDepositorInsertsh-Ctrl
UseRetroviralExpressionMammalianPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_SSRP1_1
Plasmid#72371PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 2434
Plasmid#37211DepositorAvailable sinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 1320
Plasmid#37210DepositorAvailable sinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pENTR APLP1 shRNA 2
Plasmid#30157DepositorInsertAPLP1 shRNA 2
ExpressionMammalianAvailable sinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT13
Plasmid#223385PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only