We narrowed to 15,702 results for: grna
-
Plasmid#126883PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Pi21
Plasmid#126904PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3405
Plasmid#106166PurposeEasyCloneYALI system-based yeast episomal vector carrying a nourseothricin-resistance marker for Yarrowia lipolytica, can be used for gRNA expression, amp resistanceDepositorTypeEmpty backboneExpressionYeastAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFD4d-U6-1:white1-U6-3:white1
Plasmid#84005PurposepCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoterDepositorInsertswhite sgRNA-1
white sgRNA-1
UseCRISPRPromoterU6:1, U6:3, and dU6-1; dU6-3Available SinceJan. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC1815_pCR8-gSMN2-DN3
Plasmid#118648PurposeTransient transfection; Expressed SMN2-DN3 CasRx gRNA; Gateway DonorDepositorInsertgSMN2-DN3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V2
Plasmid#226955PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-hSt3Cas9 (pXK-1721)
Plasmid#208828PurposeCRISPR/hSt3Cas9 expression vector for Animal gene editing, harboring the humanized St3Cas9 gene and the corresponding optimized SP1.gRNA. Key Construct: mU6- SP1.gRNA-CMV-hSt3Cas9.DepositorTypeEmpty backboneUseCRISPR; Stcas9ExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 g4+g17
Plasmid#120252PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with two guide RNAsDepositorInsertg17_U6_g4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
GG-dest
Plasmid#69538PurposeDestination plasmid for gRNA concatenation Golden Gate cloningDepositorTypeEmpty backboneAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSABEd
Plasmid#133968PurposeExpresses ABEd CRISPR base editor and gRNA scaffold in StreptomycesDepositorArticleInsertABEd
UseCRISPR and Synthetic BiologyAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM733
Plasmid#68898PurposeIPTG-inducible CRISPRi vector targeting NanoLuc (NL4), constiutive NanoLuc, pNBU2 backbone, AmpRDepositorInsertsdCas9
LacI
sgRNA
NanoLuc
Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRDA_887
Plasmid#201164PurposeLentiviral expression of EnAsCas12a CRISPRa gRNA with N' nanobody-ALFA and C' p65 and NLSDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEFSAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)
Plasmid#47870PurposeAll-in-one plasmid targeting human OCT4, cuts roughly ~84bp downstream of stop codon.DepositorInsertsNmCas9
U6pr-tracrRNA
OCT4 crRNA
UseCRISPRTagsHA and NLSExpressionMammalianAvailable SinceSept. 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
reporter-gT2
Plasmid#47321PurposeTF reporter for gRNA-AAVS1_T2 (RNA-guided dTomato expression)DepositorInsertminCMV-dTomato_pA
UseCRISPRAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-tagBFP
Plasmid#217007Purposelentiviral plasmid for gRNA cloning with selectable tagBFP expressionDepositorTypeEmpty backboneUseLentiviralAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPomyces-Sth1Cas9
Plasmid#129552PurposeContains codon-optimized Sth1Cas9 and gRNA for streptomycesDepositorInsertSth1Cas9
ExpressionBacterialPromoterrpsL(XC)-BbsIAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only