We narrowed to 9,762 results for: CAG
-
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only
-
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001149093)
Plasmid#77788Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AKT1 gRNA (BRDN0001146935)
Plasmid#75500Purpose3rd generation lentiviral gRNA plasmid targeting human AKT1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(43))-PGKpuro2ABFP-W
Plasmid#200464PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(43) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147355)
Plasmid#77787Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgAAVS1
Plasmid#83906Purposestable knockoutDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
Plasmid#91879PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Ezh2DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001146868)
Plasmid#76217Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001148417)
Plasmid#77924Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1-C911
Plasmid#125784Purposea seed-matched control for pRSITEP-puro-shWRN1DepositorInsertshWRN1-C911 (WRN Human)
UseRNAiAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001145772)
Plasmid#77862Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-5
Plasmid#118023PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only