We narrowed to 27,272 results for: gfp
-
Plasmid#46957PurposePlasmid for cloning and epression of GFP-FLAG tagged human Ku70 (N-terminal tag). Confers resistance to G418.DepositorAvailable SinceAug. 20, 2013AvailabilityAcademic Institutions and Nonprofits only
-
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dot1LCD
Plasmid#235582PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Dot1l fused with scFV to programme H3K79me2DepositorInsertDot1l (Dot1l Mouse)
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa
Plasmid#127389PurposeFluorescent reporter for Ca2+/calmodulin-dependent protein kinase II alphaDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianPromoterpCAGAvailable SinceNov. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
rTetR-GFP-VP16
Plasmid#183917PurposeVP16 activation domain coupled to reverse Tet repressor; labeled with GFP; binds tetO sites upon doxycycline additionDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-63: ACTN2-mEGFP
Plasmid#124607PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human ACTN2, via excisable Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertACTN2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (ACTN2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBad-sfGFP 150TAG
Plasmid#85483PurposeArabinose inducible E. coli codon optimized superfolder GFP with TAG stop codon at position 150DepositorInsertsuperfolder GFP 150TAG
ExpressionBacterialMutation150TAG (amino acid 150 mutated to stop codon)PromoterArabinoseAvailable SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH-roGFP2-ORP1
Plasmid#191677PurposeTi plasmid pICH86988 harbouring roGFP2-ORP1 for peroxide detection in plant cells.DepositorInsertredox(ro)GFP2-ORP1
UseBinary agrobacterium ti plasmidExpressionPlantPromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP-bleMX6
Plasmid#33141Purposegenomic GFP tagging in yeastDepositorInsertsbleMX6
GFP
Available SinceJan. 19, 2012AvailabilityAcademic Institutions and Nonprofits only