We narrowed to 5,098 results for: Mos

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#171645

Expression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cells

Dennis Ko

Antonia et al PLoS Negl Trop Dis. 2021 Oct 28;15(10):e

Dec. 20, 2021

Academic Institutions and Nonprofits only

#119556

Level T acceptor vector for chromosomal integration with lacZ compatible with blue/white screening. Modified pUC19 vector.

Alistair McCormick

Vasudevan et al Plant Physiol. 2019 May;180(1):39-55. do

Aug. 5, 2019

Academic Institutions and Nonprofits only

#117990

Chloroplast-targeted expression of CURT_fluoA controlled by the CaMV 35S promoter

Mathias Pribil

Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.102

March 22, 2019

Academic Institutions and Nonprofits only

#117991

Chloroplast-targeted expression of CURT_fluoB controlled by the CaMV 35S promoter

Mathias Pribil

Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.102

March 22, 2019

Academic Institutions and Nonprofits only

#117992

Chloroplast-targeted expression of CURT_fluoE controlled by the CaMV 35S promoter

Mathias Pribil

Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.102

March 22, 2019

Academic Institutions and Nonprofits only

#117995

Expression of CURT_flouB controlled by the CaMV 35S promoter

Mathias Pribil

Behrendorff et al ACS Synth Biol. 2019 Mar 18. doi: 10.102

March 22, 2019

Academic Institutions and Nonprofits only

#106164

EasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6681 into Yarrowia lipolytica chromosomal location IntE_3, amp resistance

Irina Borodina

Holkenbrink et al Biotechnol J. 2018 Jan 29. doi: 10.1002/

May 11, 2018

Academic Institutions and Nonprofits only

#64811

SPL9 expression in yeast

Detlef Weigel

Rubio-Somoza et al Curr Biol. 2014 Nov 17;24(22):2714-9. do

Aug. 26, 2015

Academic Institutions and Nonprofits only

#110095

Vector for low-level constitutive expression in mycobacteria from the Tet promoter. Lacks the Tet repressor. Contains attP for chromosomal integration. Lacks the integrase and thus remains stably integrated in the absence of antibiotic selection. Contains a C-terminal 3xFLAG to allow detection of expression levels by Western blotting.

Markus Seeger

Arnold et al Sci Rep. 2018 Jun 22;8(1):9539. doi: 10.

June 20, 2018

Academic Institutions and Nonprofits only